Commit 7e0ce9a7 authored by Mikaël Salson's avatar Mikaël Salson

BRI_multi.should-vdj.fa: Bad J gene found

We find a TRGJ2*01 gene with 3 deletions at the start and an exact alignment
while the TRGJ1*02 has 0 deletion and no differences. However for us the
alignment with TRGJ2*01 is longer because we were unable to correctly retrieve
the downstream sequence for the allele TRGJ1*02 (see #3009).

See #3008.
parent ca1678a7
......@@ -28,7 +28,7 @@ cggtatggacgtctggggccaagggaccacggtcaccgtctcctcagg
# target 1297RC
>TRGV5*01 6/CCCCCGGG/0 TRGJ1*02 [TRG]
>TRGV5*01 6/CCCCCGGG/0 TRGJ1*02 [TRG] BUG
tgccttctacatccactggtacctacaccaggaggggaaggccccacagcgtcttctgtactatgacgtctc
caactcaaaggatgtgttggaatcaggactcagtccaggaaagtattatactcatacacc
caggaggtggagctggatattgatactacgaaatctaattgaaaatgattctggggtctattactgtgccac
......
Markdown is supported
0% or
You are about to add 0 people to the discussion. Proceed with caution.
Finish editing this message first!
Please register or to comment