Commit 7e0791c7 authored by Mikaël Salson's avatar Mikaël Salson

should-vdj: detail sequence

TODO -> BUG.
TODO should be limited to sequences that have not been checked
parent ca6b9015
>IGHD3-9*01 16/CT/23 IGHJ6*02 [IGH+] TODO
# read 122 CTGTGGTATTACGATATTTTCTGACGTCTGGGGCCAAGGGACCACGGTCACCGTCTCCTCAGGTAAGTATTACGATATTTTCTGACG 147
# IGHD3-9*01 0 .....GTATTACGATATTTTgactggttattataac 31
# IGHJ6*02 0 attactactactactacggtatgGACGTCTGGGGCCAAGGGACCACGGTCACCGTCTCCTCA
>IGHD3-9*01 16/CT/23 IGHJ6*02 [IGH+] BUG
CTTTTTTTTTTTTTTTTTTTTTTTTTTTTTAATGATACGGCGACCACCGAGATCTACACTATAGCCTACACTCTTTCCCTACACGACGCTCTTCCGATCTGTTTGGAGTGAGGTCTGTGTCACTGTGGTATTACGATATTTT
CT
GACGTCTGGGGCCAAGGGACCACGGTCACCGTCTCCTCAGGTAAG
......
Markdown is supported
0% or
You are about to add 0 people to the discussion. Proceed with caution.
Finish editing this message first!
Please register or to comment