Commit 7b3cb057 authored by Mathieu Giraud's avatar Mathieu Giraud

tests: extend data/ambiguous_representative.fa with noisy sequences at both ends

parent a916080d
......@@ -7,7 +7,10 @@ $ Window found
1:^CACCCCCCCCCTTTTTTTCT$
$ Representative computation
1:>clone-001--custom--0000004--100%--seq.-\\[0,41\\]
1:>clone-001--custom--0000004--100%--seq.-\\[8,49\\]
$ Representative sequence
1: TATATGTATANCACCCCCCCCCTTTTTTTCTNGCGCGAGCGA
$ Representative sequence has the good length, it does not extend towards noisy sequences
2: 42 bp .... of 58.. bp.
# (see toy_{V,J}.fa)
# ----------nVVVVVV--------JJJJJJn---------
# TATATGTATAnCACCCCCCCCCTTTTTTTCTnGCGCGAGCGA
>seq1
TATATGTATATCACCCCCCCCCTTTTTTTCTCGCGCGAGCGA
ctctctcaTATATGTATAtCACCCCCCCCCTTTTTTTCTcGCGCGAGCGActctctct
>seq2
TATATGTATAACACCCCCCCCCTTTTTTTCTGGCGCGAGCGA
gtgtgtgtTATATGTATAaCACCCCCCCCCTTTTTTTCTgGCGCGAGCGAgtgtgtgt
>seq3
TATATGTATACCACCCCCCCCCTTTTTTTCTAGCGCGAGCGA
ttattatgTATATGTATAcCACCCCCCCCCTTTTTTTCTaGCGCGAGCGAttattatt
>seq4
TATATGTATAGCACCCCCCCCCTTTTTTTCTTGCGCGAGCGA
\ No newline at end of file
acacacacTATATGTATAgCACCCCCCCCCTTTTTTTCTtGCGCGAGCGAacacacac
Markdown is supported
0% or
You are about to add 0 people to the discussion. Proceed with caution.
Finish editing this message first!
Please register or to comment