Commit 77e91ad1 authored by Mikaël Salson's avatar Mikaël Salson

algo/tests: Add test on min_cover_representative

Checks previous commit
parent 5c9296f9
# seq1, 2, 3, 4 are identical
# One insertion has been added both in seq4 and seq5 (different ones) in uppercase.
>seq1
ggctggagtgggtttcatacattagtagtaatagtggtgccatatactacgcagactctgtgaagggccgattcaccatc
tccagaaacaatgccaaggactcactgtatctgcaaatgaacagcctgagagccgaggacacggctgtgtattactgtgc
gagagcgatcccccggtattactatgatactagtggcccaaacgactactggggccagggaaccctggtcaccgtctcct
cag
>seq2
ggctggagtgggtttcatacattagtagtaatagtggtgccatatactacgcagactctgtgaagggccgattcaccatc
tccagaaacaatgccaaggactcactgtatctgcaaatgaacagcctgagagccgaggacacggctgtgtattactgtgc
gagagcgatcccccggtattactatgatactagtggcccaaacgactactggggccagggaaccctggtcaccgtctcct
cag
>seq3
ggctggagtgggtttcatacattagtagtaatagtggtgccatatactacgcagactctgtgaagggccgattcaccatc
tccagaaacaatgccaaggactcactgtatctgcaaatgaacagcctgagagccgaggacacggctgtgtattactgtgc
gagagcgatcccccggtattactatgatactagtggcccaaacgactactggggccagggaaccctggtcaccgtctcct
cag
>seq4
ggctggagtgggtttcatacattagtagtaatagtggtgccatatactacgcagactctgtgaagggccgattcaccatc
tccagaaacaatgccaaggactcactgtatctgcaaatgAaacagcctgagagccgaggacacggctgtgtattactgtgc
gagagcgatcccccggtattactatgatactagtggcccaaacgactactggggccagggaaccctggtcaccgtctcct
cag
>seq5
ggctggagtgggtttcatacattagtagtaatagtggtgccatatactacgcagactctgtgaagggccgattcaccatc
tccagaaacaatgccaaggactcactgtatctgcaaatgaacagcctgagagAccgaggacacggctgtgtattactgtgc
gagagcgatcccccggtattactatgatactagtggcccaaacgactactggggccagggaaccctggtcaccgtctcct
cag
!LAUNCH: $VIDJIL_DIR/$EXEC $VIDJIL_DEFAULT_OPTIONS -r 5 -g $VIDJIL_DIR/germline/homo-sapiens.g:IGH $VIDJIL_DATA/representative-few-reads.fa
$ Consensus sequence should span on the whole sequence
1: clone.*99% of 243
Markdown is supported
0% or
You are about to add 0 people to the discussion. Proceed with caution.
Finish editing this message first!
Please register or to comment