Commit 771fe521 authored by Mikaël Salson's avatar Mikaël Salson

browser/test/functional: Can't match window by title

For some reason with this version of Watir both titles are empty.
Thus we have to match on the URL.
parent 4e4ee560
......@@ -204,9 +204,9 @@ class TestMultilocus < BrowserTest
$b.clone_in_scatterplot('90').click(:control)
$b.menu_item_export_fasta.click
assert ( $b.window(:title => "").exists? ) , ">> fail opening fasta export "
$b.window(:title => "").use do
assert ($b.text.include? ">TRBV29*01 -1/0/-0 TRBD1*01 -2/0/-5 TRBJ2-5*01"), "header name"
assert ( $b.window(:url => /about:blank/ )) , ">> fail opening fasta export "
$b.window(:url => /about:blank/).use do
assert ($b.text.include? ">TRBV29*01 -1/0/-0 TRBD1*01 -2/0/-5 TRBJ2-5*01"), "header name: "+$b.text
assert ($b.text.include? "YYGGGYYACGYAYAGCGGYGYTTYYCCTYTYTGYTYTGCYAAAYAACYYYYTGTGYCTYTGTGCYGYGTTYCCCGGYYYAAACYCYCYYCCTYGG\nCYAGGYCYGG"), "sequence"
assert ($b.text.include? ">ERG-4F 0/TCT/0 ERG-Seq-R"), "header name locus ERG"
assert (not $b.text.include? ">ERG-4F\n"), "header name of segment should not exist (segment is not present in germline)"
......
......@@ -75,8 +75,8 @@ GGGGGAGGCTTGGTACAGCCTGGGGGGTCCCTGAGACTCTCCTGTGCAGCCTCTGGATTCACCTTCAGTAGCTACGACAT
def test_07_export_fasta
$b.element(:id => 'btn_exportfasta').click
assert ( $b.window(:title => "").exists? ) , ">> fail opening fasta export "
$b.window(:title => "").use do
assert ( $b.window(:url => /about:blank/).exists? ) , ">> fail opening fasta export "
$b.window(:url => /about:blank/).use do
assert ($b.text.index(/TRGV5.*200 nt/) > 0), "header name"
assert ($b.text.index(/IGHV3-13.*374 nt/) > 0), "header name"
assert ($b.text.include? "CCTGGG\nGGGCCAG\nATT"), "sequence"
......
Markdown is supported
0% or
You are about to add 0 people to the discussion. Proceed with caution.
Finish editing this message first!
Please register or to comment