Commit 757185a9 authored by Mathieu Giraud's avatar Mathieu Giraud

Merge branch 'feature-ag/new-germlines' into 'dev'

Update germlines

See merge request !247
parents adaf470b de978abc
Pipeline #32979 passed with stages
in 52 seconds
......@@ -3,25 +3,25 @@
$ Check md5 in germline/, sequences split and processed from germline and other databases
1:b64be21f03b290c6850ce2cb2f1d6f02 homo-sapiens/IGHD.fa
1:f38ca03b7672641c7b3c0e7787311bb8 homo-sapiens/IGHJ.fa
1:e4da5f60a89df3879538bf00d9e7f5c9 homo-sapiens/IGHV.fa
1:6a64f90ea2d19721d410c545e9d0bb9e homo-sapiens/IGHJ.fa
1:73e6adab4faeb48b4fc2904e3a6e90f8 homo-sapiens/IGHV.fa
1:0367825e404f753f0890b8f52aec7502 homo-sapiens/IGKJ.fa
1:10ffddf98d73396b46c521c6999bbd09 homo-sapiens/IGKV.fa
1:820188b335764f0eb04578ea35bbb143 homo-sapiens/IGKV.fa
1:af257e110cf1ec6c38457af82a8118aa homo-sapiens/IGLJ.fa
1:721f5afdf6ea9af5bafad4226d7e7f15 homo-sapiens/IGLV.fa
1:bf915f443a26733f82391baae221c0d4 homo-sapiens/TRAJ.fa
1:26013bcd4988623da89900646ce94387 homo-sapiens/TRAV.fa
1:d6fa96cbc4de984729154c9d2217e3d2 homo-sapiens/IGLV.fa
1:f0c43d7b0074e155aef411ea7353c23e homo-sapiens/TRAJ.fa
1:935d588445e94d575c412cb3699b6bff homo-sapiens/TRAV.fa
1:5b74170b9c45b9243558941bf07666ff homo-sapiens/TRBD.fa
1:b9f8390d1d18a9ef5db9ab6875e196f1 homo-sapiens/TRBJ.fa
1:b27a826a947b2fe17c82799753773538 homo-sapiens/TRBV.fa
1:6540dc6a0e4f84de208a8b1f5d9fa981 homo-sapiens/TRBV.fa
1:7f9fe8eaf781cf87453c157a771d5aaf homo-sapiens/TRDD.fa
1:e50fc3c2f786f0b5a2b6fb5834dd3814 homo-sapiens/TRDJ.fa
1:1dbb96884c9d479af59e216d4a9f7143 homo-sapiens/TRDV.fa
1:4f6495933de0b93cfcc2e4ac00d1ecaa homo-sapiens/TRGJ.fa
1:6094243f35263dfcc96e75adbfe8c04b homo-sapiens/TRGV.fa
1:36dbb85d696634b8ee6ba0dc7500af85 homo-sapiens/TRDV.fa
1:552cbc4883f3524fdc871fc156ecfdde homo-sapiens/TRGJ.fa
1:e50df5cf337648190bc59609fe5fb5e0 homo-sapiens/TRGV.fa
1:6f585362d727b243dd284ede15118670 mus-musculus/IGHD.fa
1:218632e3e3c4fcd4c9ca7281e8976e3a mus-musculus/IGHJ.fa
1:5cdc40857ff3084ed2d7163706b11f1d mus-musculus/IGHV.fa
1:d389ee1e204699942ec1185fad8cd3df mus-musculus/IGHV.fa
1:47568ad1ee648410b734c3b33f4a9eea mus-musculus/IGKJ.fa
1:e2774dbad5e73f3b0c1e46aeab285baa mus-musculus/IGKV.fa
1:750276a78c3b55f378449ecdcb9c3f78 mus-musculus/IGLJ.fa
......@@ -38,14 +38,14 @@ $ Check md5 in germline/, sequences split and processed from germline and other
1:982c0fc1208d066bc028621e94d2b466 mus-musculus/TRGV.fa
1:d55f4acf266d3bae4a7f9b3aa1881abc rattus-norvegicus/IGHD.fa
1:07fa1dbe7a70f34c9a4e42ba9e9d7ca1 rattus-norvegicus/IGHJ.fa
1:f5382906485e36c05fb6cbd877eb2896 rattus-norvegicus/IGHV.fa
1:877b03603ec7e2a99d10184c3636f635 rattus-norvegicus/IGHV.fa
1:c5ca90bea438f929308c5d57dfb1dc6b rattus-norvegicus/IGKV.fa
1:96bc9d75e6b072e5d643c195ed562497 rattus-norvegicus/IGLJ.fa
1:7e5c54685597270f333b41b70aef74ad rattus-norvegicus/IGLV.fa
$ Check md5 in germline/, other sequences
1:957b46da4114a1ed66f2e9b5d06aff2a homo-sapiens/CD.fa
1:9112d6975669ccb59970fa79ceef599d homo-sapiens/CD-sorting.fa
1:e6540659d36fa37f83f7e1463dde906f homo-sapiens/CD.fa
1:eb32e780af5a4b8c0d1e9d780bacac43 homo-sapiens/IGHC=A1.fa
1:b1ea36c4255c63d775ecdb03967ec89e homo-sapiens/IGHC=A2.fa
1:43c54f3ddedfde87f70b0e0bea2d6d5f homo-sapiens/IGHC=D.fa
......@@ -56,20 +56,20 @@ $ Check md5 in germline/, other sequences
1:d5123a856e2dedacfcfcd5fd11ebc2bc homo-sapiens/IGHC=G4.fa
1:6c1e3e61d5824a03f71a5527ccdbb35c homo-sapiens/IGHC=GP.fa
1:dd2263230c64abb9a22f5f8b7a979275 homo-sapiens/IGHC=M.fa
1:2ed67cdd3d8f8fe3096afe747a0df205 homo-sapiens/IGHD.up.fa
1:a13a4c31570952c6c7fc1e7161051675 homo-sapiens/IGHJ.down.fa
1:cbf6cde7e7391c58229f815034cfbfa3 homo-sapiens/IGHD.up.fa
1:3fb492cfdbd9f9e640d15e457f7af82f homo-sapiens/IGHJ.down.fa
1:7d6247262807ad5478b7a4e52a59c568 homo-sapiens/IGK-INTRON.fa
1:17d62684cad533025a25401cf7974d50 homo-sapiens/IGKJ.down.fa
1:1147a04c4e8a8dd534aae65db1ae13ca homo-sapiens/IGK-KDE.fa
1:805f326b92db78d8276b5a58b0f93fa2 homo-sapiens/IGKJ.down.fa
1:9f37008bdabf1d7102d753845e36309e homo-sapiens/IGLJ.down.fa
1:68e06198c4f41898533fecd30b86a446 homo-sapiens/TRAJ.down.fa
1:79f9526d456d4550c1451a67e34efa51 homo-sapiens/TRBD.up.fa
1:052da0d01539810a3ede514ade7ec988 homo-sapiens/TRBJ.down.fa
1:e0a1860c5f9f937800c4b9d090f0c8aa homo-sapiens/TRDD.up.fa
1:4f1d8f0e508e7e40adbd8896b64a905c homo-sapiens/TRDD2.up.fa
1:d8017c8ee68383b874f7ff00efab0db6 homo-sapiens/TRDD3.down.fa
1:a0a77c861cb4abc5222fad9da143e2b9 homo-sapiens/TRDJ.down.fa
1:f1ae8b4f91c3ab3cad31e490f09eeff0 homo-sapiens/TRGJ.down.fa
1:c7ff31249a38e29429f5e6144123274a homo-sapiens/IGLJ.down.fa
1:25fb374147fdf5e73242b7776d9d73e2 homo-sapiens/TRAJ.down.fa
1:86ff6637be816b145fd69153d84bbcf1 homo-sapiens/TRBD.up.fa
1:a6cf4d4ea828cabba9061fa794662fff homo-sapiens/TRBJ.down.fa
1:ff05546d9fa09c81c82914c8af19c3a0 homo-sapiens/TRDD2.up.fa
1:7104ce2e1fc0461d475026c2a560947b homo-sapiens/TRDD3.down.fa
1:fa8fce50396e96bb7eed892f68717957 homo-sapiens/TRDD.up.fa
1:ee091b204ffdcf2b29b60d7c4435abe5 homo-sapiens/TRDJ.down.fa
1:bec6c2dfa3c4535b87a89f9ade4a25e0 homo-sapiens/TRGJ.down.fa
1:48f54c5af4f8d748ab2f02b2a6ea3370 mus-musculus/IGHC=A.fa
1:25cb0451d31ca5337d462eb648914fe7 mus-musculus/IGHC=D.fa
1:8f2ec40bc77a4e7f0c7b19655812ddbc mus-musculus/IGHC=E.fa
......@@ -79,25 +79,25 @@ $ Check md5 in germline/, other sequences
1:03cd9b5729ec3de23b302c476a51c9d3 mus-musculus/IGHC=G2C.fa
1:744e59a4b5d1fc53beae91a0bee8f34a mus-musculus/IGHC=G3.fa
1:b72bc2ed53226dd68519bb0cb679f608 mus-musculus/IGHC=M.fa
1:bacb56a07cfcd93a4734fa25a832a805 mus-musculus/IGHD.up.fa
1:07cd7e934d5ad5b804b5e8008c3f6662 mus-musculus/IGHJ.down.fa
1:94cb5eaa7f9b1732fe9f21bfaee11af7 mus-musculus/IGKJ.down.fa
1:8b2a0ea8303c8bc21ca6c9669a91cc7a mus-musculus/IGLJ.down.fa
1:f3840f00f202cafd36d2cd3b17608bbd mus-musculus/TRAJ.down.fa
1:60ad210f435d4f31b37f0254bf9d96fe mus-musculus/TRBD.up.fa
1:8be584820144e5f8960ac71361752f10 mus-musculus/TRBJ.down.fa
1:97a0118ff5659b8e46e937e3b4afa43c mus-musculus/TRDD.up.fa
1:b1e00c7630580fd3c79801ae9174734d mus-musculus/TRDD2.up.fa
1:5481f5e78573695406baa58a04689d2c mus-musculus/TRDJ.down.fa
1:1d823716238ad85afe903fa7db8604c2 mus-musculus/TRGJ.down.fa
1:123ebf4aaaa3b530c1911c0febcd74a5 mus-musculus/IGHD.up.fa
1:8353980dac74af8bffe3de0b746a897e mus-musculus/IGHJ.down.fa
1:f6282c17fb689899d37627df79194b38 mus-musculus/IGKJ.down.fa
1:9716ccba4912b32c462cad5c0cd82bed mus-musculus/IGLJ.down.fa
1:d3e2887e41fac79c6287c630050dcffe mus-musculus/TRAJ.down.fa
1:89bcd757dfd42615307d9970307f6e01 mus-musculus/TRBD.up.fa
1:29d23ea1a84881b21bcf38cd004b94e3 mus-musculus/TRBJ.down.fa
1:a3dd73f39e659c3008d3f595c7731792 mus-musculus/TRDD2.up.fa
1:ffa36242abfedd81c563ddf74a8d304a mus-musculus/TRDD.up.fa
1:c709bb05205022b0aefad45b4eb72169 mus-musculus/TRDJ.down.fa
1:a234e3568f9553eef28799b8d5189d81 mus-musculus/TRGJ.down.fa
1:90075c7d51bd1d08892163848a8f2ecc rattus-norvegicus/IGHC=A.fa
1:e0d2d3e90980bf783e35d3775a3c327d rattus-norvegicus/IGHC=D.fa
1:6cf27ae32f98ec8f912e0d07b46a2139 rattus-norvegicus/IGHC=D.fa
1:8461bb440ad2264eb638d948bda186ab rattus-norvegicus/IGHC=E.fa
1:72537faac0e87d1265c7806c300a41ce rattus-norvegicus/IGHC=G1.fa
1:4234f1b5e763f51782c88358e2085714 rattus-norvegicus/IGHC=G2A.fa
1:6f2605929ae226fd7ebaf9b40d948a85 rattus-norvegicus/IGHC=G2B.fa
1:36f7704ea32dbc0eb71c4ffbe459c23c rattus-norvegicus/IGHC=G2C.fa
1:a27b6fc827063a041062a8b4b2945232 rattus-norvegicus/IGHC=M.fa
1:a122818ff4b6ef5e2013a1ae1c493425 rattus-norvegicus/IGHD.up.fa
1:84362ee627d5e3d78579aedc18ba6aef rattus-norvegicus/IGHD.up.fa
1:3445516778ab4fbf96cf4008a40e6fe2 rattus-norvegicus/IGHJ.down.fa
1:69aa6db3bb8a332289ab3b5cf5ab3b5a rattus-norvegicus/IGLJ.down.fa
1:50d821031cee5e1a3849966fafdc2ad5 rattus-norvegicus/IGLJ.down.fa
......@@ -6,4 +6,4 @@ $ Clone 13 is correctly analyzed
$ Statistics on -Z
1:Statistics on clone analysis
rb1: IGH 1579/ 10470 15..%
rb1: IGH 1[5-7][0-9]{2}/ 1[0-2][0-9]{3} 15..%
......@@ -4,7 +4,7 @@ $ number of reads and kmers
1:13153 reads, 3020179 kmers
$ k-mers, IGHV
1:13115 .* 1222841 .*IGHV
1:13115 .* 1222984 .*IGHV
$ k-mers, IGHJ
1:38 .* 435867 .*IGHJ
......@@ -13,5 +13,5 @@ $ k-mers, ambiguous
1:47648 .*\\?
$ k-mers, unknown
1:1251709 .*_
1:1251567 .*_
......@@ -7,10 +7,10 @@ $ Find the good number of "too short sequences" for windows of size 100
1: UNSEG too short w -> 0
$ Some reads have shortened or shifted windows
1: SEG changed w -> 1368
1: SEG changed w -> 1369
$ Most changed windows are just shifted
913: w100/-5
914: w100/-5
360: w100/-10
$ Some changed windows are lighlty shortened
......@@ -24,7 +24,7 @@ $ Find the good number of windows in Stanford S22
1: found 11835 windows in 13152 reads
$ Find the correct number of clones with shifted of shortened windows
1243: "Short or shifted window"
1243: "W50"
1244: "Short or shifted window"
1244: "W50"
......@@ -5,7 +5,7 @@ $ Germlines are custom
1: custom germlines
$ Parses IGHV.fa germline
1: 101925 bp in 349 sequences
1: 104369 bp in 357 sequences
$ Parses IGHD.fa germline
1: 1070 bp in 44 sequences
......
>TRBD2*02 8/10/2 TRBJ2-7*01 [TRB+]
# TRBD2*01 GCAGGGAGGAAACATTTTTGTATCATGGTGTAACATTGTGGGGACTAGCGGGGGGG
# ||||||||||||||||||||||||||||||||||||||||||||||||
# read CTGCGCTTCCTGCCGCTGCCcaGTGGTTGGGGGAGGGGGACtaGCAGGGAGGAAACATTTTTGTATcaTGGTGTAACATTGTGGGGACTAGTGTCAGTCCCCCTACGAGCAGTACTTCGGGCCGGGCACCAGGCTCACGGTTACAGGTAAG
# ||||||||||||||||||||||||||||||||||||||||||||||||
# TRBD2*02 GCAGGGAGGAAACATTTTTGTATCATGGTGTAACATTGTGGGGACTAGCGGGAGGG
>TRBD2 8/10/2 TRBJ2-7*01 [TRB+]
CTGCGCTTCCTGCCGCTGCCcaGTGGTTGGGGGAGGGGGACtaGCAGGGAGGAAACATTTTTGTATcaTGGTGTAACATTGTGGGGACTAGTGTCAGTCCCCCTACGAGCAGTACTTCGGGCCGGGCACCAGGCTCACGGTTACAGGTAAGA
>TRBD2*02 3/9/7 TRBJ2-1*01 [TRB+]
CTGCGCTTCCTGCCGCTGCCcaGTGGTTggggGAGGGGGACtaGCAGGGAGGAAACATTTTTGTATATGGTGTAACATTGTGGGGACTAGCGGGAAGTAGGAGGAATGAgCAGTTCTTCGGGCCAGGGACACGGCTCACCGTGCTAGGTAAGAAGG
......
......@@ -9,7 +9,7 @@ CGTGGCACCGCGAGCTGTAGACAGAGCCGCGGTCTTTCTCGATTGAGTGGCTTTGGTGGCCATGCCACCGCGCTCTTGGG
>IGKV3-7*04 1/GTGGA/11 KDE [IGK+]
CCCAGGCTCCTCATCTATGATGCATCCACCAGGGCCACTAGCATCCCAGCCAGGTTCAGTGGCAGTGGGTCTGGGACAGACTTCACTCTCACCATCAGCAGCCTGCAGCCTGAAGATTTTGCAGTTTATTACTGTCAGCAGGATTATAACTTACCTCGTGGAGGCAGCCCAGGGCGACTCCTCATGAGTCTGCAGCTGCATTTTTGCCATATCCACTATTTGGAGTCTGACCTCCCTAGGAAGCCTCCCTGCTCCCTAGGACAACCTGCTCTGACCTCTGAGG
>TRGV2*01 9/CCCTGG/1 TRGJP1*01 [TRG] {CATPW!TTGWFKIF}
>TRGV2*03 9/CCCTGG/1 TRGJP1*01 [TRG] {CATPW!TTGWFKIF}
GGAAGGCCCCACAGCGTCTTCAGTACTATGACTCCTACAACTCCAAGGTTGTGTTGGAATCAGGAGTCAGTCCAGGGAAGTATTATACTTACGCAAGCACAAGGAACAACTTGAGATTGATACTGCGAAATCTAATTGAAAATGACTTTGGGGTCTATTACTGTGCCACCCCCTGGTACCACTGGTTGGTTCAAGATATTTGCTGAAGGGACTAAGCTCATAGTAACTTCGCCTGGTAA
# or TRGJ1*01
......
......@@ -11,7 +11,7 @@ TTTGACTACTGGGGCCAGGGAACCCTGGTCACCGTCTCCTCAGGTAAG
# target 1297RC
>IGHV2-70D*04 4/TCCCG/10 IGHD3-10*01 10/CCTTG/0 IGHJ5*02 [IGH]
>(IGHV2-70D*04, IGHV2-70*04) 4/TCCCG/10 IGHD3-10*01 10/CCTTG/0 IGHJ5*02 [IGH]
gacctgcaccttctctgggttctcactcagcactagtggaatgcgtgcgagctggatccgtcagcccccagg
gaaggccctggagtggcttgcacgcattgattgggatgatgataaattctacagcacatctctgaagaccag
gctcaccatctccaaggacacctccaaaaaccaggtggtccttacaatgaccaacatggaccctgtggacac
......
......@@ -35,7 +35,7 @@ GGCTTATCCTTCGTAGCTATGCTATGCACTGGGTCCGCCAGGCTCCAGGGAAGGGACTGGAATAGTGTTTCAGCTATTAG
CGGGGTAGGTCTCTGCAGGCTTCTGGAGGCACCTTCAGCAGCTATGCTATCAGCTGGGTGCGACAGGCCCCTGGACAAGGGCTTGAGTGGATGGGAGGGATCATCCCTATCTTTGGTACAGCAAACTACGCACAGAAGTTCCAGGGCAGAGTCACGATTACCGCGGACGAATCCACGAGCACAGCCTACATGGAGCTGAGCAGCCTGAGATCTGAGGACACGGCCGTGTATTACTGTGCGAGAGATAAGGCCAGTATTATCCCGTGGAGGACGTCTGGGGCCAAGGGACCACGGTCACCGTCTCCTCAGGTA
#1465 vh6
>IGHV6-1*01 4/14/1 IGHD2-2*01 7/8/6 IGHJ6*02 [IGH]
>IGHV6-1*01 4/14/1 (IGHD2-2*01, IGHD2-2*02) 7/8/6 IGHJ6*02 [IGH]
CTCCTGTGCATCTCCGGGGACAGTGTCTCTAGCAACAGTGCTGCTTGGAACTGGATCAGGCAGTCCCCATCGAGAGGCCTTGAGTGGCTGGGAAGGACATACTACAGGTCCAAGTGGTATAATGATTATGCAGTATCTGTGAAAAGTCGAATAACCATCAACCCAGACACATCCAAGAACCAGTTCTCCCTGCAGCTGAACTCTGTGACTCCCGAGGACACGGCTGTGTATTACTGTGCAACGGGGGGTTCTGCGGGATATTGTAGTAGTACCAGCTGTCCCTCGGACTACTACTACGGTATGGACGTCTGGGGCCAAGGGACCACGGTCACCGTCTCCTCAGGT
#1465 dh3
......@@ -80,11 +80,11 @@ GCTGGCAGATTCTGCAGGCATCTGGATACACCTTCACCAGCTACTATATGCACTGGGTGCGACAGGCCCCTGGACAAGGG
CGGGGTAGTCTCCTGCAGCTTCTGGAGGCACCTTCAGCAGCTATGCTATCAGCTGGGTGCGACAGGCCCCTGGACAAGGGCTTGAGTGGATGGGAGGGATCATCCCTATCTTTGGTACAGCAAACTACGCACAGAAGTTCCAGGGCAGAGTCACGATTACCGCGGACGAATCCACGAGCACAGCCTACATGGAGCTGAGCAGCCTGAGATCTGAGGACACGGCCGTGTATTACTGTGCGAGGGGGGGCTGGAACTACTACTACGGTATGGACGTCTGGGGCCAAGGGACCACGGTCACCGTCTCCTCAGGTAAAACTTATCCTTGGAAAGACGTCATCCGTAGTAGTAGTTCAGCCCCCCTGCCGTAATACAGGCCGTGTCTCGATCTCAGCGGCTCACTCCTGGTGGGCTGTGCTTGTGGAATTCTCCCGGTAATCGTGACTTTGCCCTGGAAATTCTATGCCTATTGTTGCTGGACC
#1428 vh2
>IGHV2-70*04 IGHJ6*02 [IGH] BUG
>(IGHV2-70*04 IGHJ6*02, IGHV2-70D*04 IGHJ6*02) [IGH]
CCACAGACCCTCACACTGACCTGCACCTTCTCTGGGTTCTCACTCAGCACTAGTGGAATGCGTGTGAGCTGGATCCGTCAGCCCCCAGGGAAGGCCCTGGAGTGGCTTGCACGCATTGATTGGGATGATGATAAATTCTACAGCACATCTCTGAAGACCAGGCTCACCATCTCCAAGGACACCTCCAAAAACCAGGTGGTCCTTACAATGACCAACATGGACCCTGTGGACACAGCCACGTATTACTGTGTTGGTATGGACGTCTGGGGCCAAGGGACCACGGTCACCGTCTCCTCAGGTAAAACCACGTCCTTGGCCCGACTCCATACCACACCTAATACCTGGCTGTGTCCACGAGGATCCATGGTTGGGCATTGTAGGACCACTGGTTTTTGGAAGTTCCCTTGAGAAAAGAAAAACAGAATCTTCAAAAAA
#1428 vh3
>(IGHV3-30*18, IGHV3-30-5*01) IGHD3-22*01 IGHJ2*01 [IGH]
>(IGHV3-30*18 IGHD3-22*01 IGHJ2*01, IGHV3-30-5*01 IGHD3-22*01 IGHJ2*01) [IGH]
CGCCATGATCTTCGTAGCTATGGCATGCACTGGGTCCGCCAGGCTCCAGGCAAGGGGCTGGAGTGGGTGGCAGTTATATCATATGATGGAAGTAATAAATACTATGCAGACTCCGTGAAGGGCCGATTCACCATCTCCAGAGACAATTCCAAGAACACGCTGTATCTGCAAATGAACAGCCTGAGAGCTGAGGACACGGCTGTGTATTACTGTGCGAACCGAGACCCTAATTCCTTTTATTACTATGATAGTAGTGGTTATTTGGTACTTCGATCTCTGGGGCCGTGGCACCCTGGTCACCGTCTCCTCAGGTCAAACCAGGTGCAGGCGCATGATCGAAGTACAAATAACACTACTATCAAAGTAATAAAAGGGAATTATGGGTTCGGTTCCACGTTA
#1428 vh4
......@@ -100,7 +100,7 @@ TAGTCTCCTGCAGGCTTCTGGATACACCTTCACCGGCTACTATATGCACTGGGTGCGACAGGCCCCTGSACAAGGGCTTG
GTAGCTATGCTATGCACTGGGTCCGCCAGGCTCCAGGCAAGGGGCTGGAGTGGGTGGCAGTTATATCATATGATGGAAGCAATAAATACTACGCAGACTCCGTGAAGGGCCGATTCACCATCTCCAGAGACAATTCCAAGAACACGCTGTATCTGCAAATGAACAGCCTGAGAGCTGAGGACACGGCTGTGTATTACTGTGCGAGAGGGATAAAACGGTATAGCAGCAGCTGGGGGAGAACAACTGGTTCGACCCCTGGGGCCAGGGAACCCTGGTCACCGTCTCCTCAGGTA
#1416 dh5
>IGHD5-18*01 5/12/15 IGHJ6*03 [IGH+] BUG
>(IGHD5-18*01, IGHD5-5*01) 5/12/15 IGHJ6*03 [IGH+]
ACCCCMTGTCCAGTCCTGGGGGCCCCTGGCACAGCTGTCTGGACCCTCTCTATTCCCTGGGAAGCTCCYCCTGACAGCCCCGCCTCCAGTTCCAGGTGTGGTTATTGTCAGGGGGTGTCAGACTGTGGTGGATACAGCTATGACCCCCCCAAAGACTACATGGACGTCTGGGGCAAAGGGACCACGGTCACCGTCTCCTCAGG
#1411 vh1
......@@ -156,7 +156,7 @@ AGCTCTGCTGATTTGTGGGCACTTATGAACCCGAAAGGACATGGCCATGGGGTGGGTAGGGACATAGGGACAGATGCCAG
CGCCCCACTTGATATTCCTTTTAGCCAGCTATGCCATGAGCTGGGTCCGCCAGGCTCCAGGGAAGGGGCTGGAGTGGGTCTCAGCTATTAGTGGTAGTGGTGGTAGCACATACTACGCAGACTCCGTGAAGGGCCGGTTCACCATCTCCAGAGACAATTCCAAGAACACGCTGTATCTGCAAATGAACAGCCTGAGAGCCGAGGACACGGCCGTATATTACTGTGCGAAAGGGTGGGAGGTATTAAACTATGGTTCGGGGAGTTATTATAACGTTGATGCTTTTGATATCTGGGGCCAAGGGACAATGGTCACCGTCTCCTCAGGTAACTC
#1347 vh2
>IGHV2-26*01 0/5/5 IGHD5-24*01 4/13/7 IGHJ4*02 [IGH]
>IGHV2-26*02 0/5/5 IGHD5-24*01 4/13/7 IGHJ4*02 [IGH] BUG-LOCUS
TCAGAGACCTCACGCTGACCTGCACCGTCTCTGGGTTCTCACTCAGCAATGCTAGAATGGGTGTGAGCTGGATCCGTCAGCCCCCAGGGAAGGCCCTGGAGTGGCTTGCACACATTTTTTCGAATGACAAAAAATCCTACAGCACATCTCTGAAGAGCAGGCTCACCATCTCCAAGGACACCTCCAAAAGCCAGGTGGTCCTTACCATGACCAATATGGACCCTGTGGACACAGCCACATATTACTGTGCATGGATACCCGAGGATGGCTACAACGACAAGAGCCAATGACTACTGGGGCCAGGGAACGCTGGTCACCGTCTCCTCAGGTAAATCCATGCACAGTAATATGTGGCTGTGTCCACAGGGTCCATATTGGTCATGGTAAGGACCACCTGGCTTTTGGAGGTGTCCTTGGAGA
#1339 vh3
......@@ -164,15 +164,21 @@ TCAGAGACCTCACGCTGACCTGCACCGTCTCTGGGTTCTCACTCAGCAATGCTAGAATGGGTGTGAGCTGGATCCGTCAG
GAACGGATAACTTCGTAGCTATGGCATGCACTGGGTCCGCCAGGCTCCAGGCAAGGGGCTGGAGTGGGTGGCAGTTATATGGTATGATGGAAGTAATAAATACTATGCAGACTCCGTGAAGGGCCGATTCACCATCTCCAGAGACAATTCCAAGAACACGCTGTATCTGCAAATGAACAGCCTGAGAGCCGAGGACACGGCTGTGTATTACTGTGCGAGAGATCGAAGTGATAGCAGTGGCTGGTTTGACTACTGGGGCCAGGGAACCCTGGTCACCGTCTCCTCAGGTAAA
#1339 dh2
>IGHD2-2*01 10/3/1 IGHJ6*02 [IGH+] BUG
>(IGHD2-2*01, IGHD2-2*02) 10/3/1 IGHJ6*02 [IGH+]
ATTAGACAAAAACCCCCTGGAATCATAGTATCAGCAGGAGAACTAGCCAGAGACAGCAAGAGGGGACTCAGTGACTCCCGCGGGGACAGGAGGATTTTGTGGGGGCTCGTGTCACTGTGAGGATATTGTAGTAGTACCAGACCTTACTACTACTACTACGGTATGGACGTCTGGGGCCAAGGGACCACGGTCACCGTCTCCTCAGGT
#1334 vh3
>IGHV3-13*01 5/6/0 IGHD7-27*01 1/16/11 IGHJ4*02 [IGH] BUG
GGAATGATCCTTCGTAGCTACGACATGCACTGGGTCCGCCAAGCTACAGGAAAAGGTCTGGAGTGGGTCTCAGCTATTGGTACTGCTGGTGACCCATACTATCCAGGCTCCGTGAAGGGCCGATTCACCATCTCCAGAGAAAATGCCAAGAACTCCTTGTATCTTCAAATGAACAGCCTGAGAGCCGGGGACACGGCTGTGTATTACTGTGCAGACACCCTAACTGGGGGGGGTTCCCTTGGGGGTACTGGGGCCAGGGAACCCTGGTCACCGTCTCCTCAGGTAA
# IGHD2-2*01 GCGGGGACAGGAGGATTTTGTGGGGGCTCGTGTCACTGTGAGGATATTGTAGTAGTACCAGCTGCTATGCC
# |||||||||||||||||||||||||||||||||
# read CTGTGAGGATATTGTAGTAGTACCAGCTGTCATATTCGGGGATATGGACGTCTGGGGCCAAGGGACCACGGTCACCGTCTCCTCAGGTCAAACC
# |||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||
# IGHD2-2*02 GCGGGGACAGGAGGATTTTGTGGGGGCTCGTGTCACTGTGAGGATATTGTAGTAGTACCAGCTGCTATACC |||||||||||||||||||||||||||||||||||||||||
# IGHJ6*02 ATTACTACTACTACTACGGTATGGACGTCTGGGGCCAAGGGACCACGGTCACCGTCTCCT
#1334 dh2
>IGHD2-2*01 7/13/19 IGHJ6*02 [IGH+] BUG
>IGHD2-2*02 2/TTCGGGGA/19 IGHJ6*02 [IGH+]
ATTAGACAAACCCCCTGGAATCATAGTATCAGCAGGAGAACTAGCCAGAGACAGCAAGAGGGGACTCAGTGACTCCCGCGGGGACAGGAGGATTTTGTGGGGGCTCGTGTCACTGTGAGGATATTGTAGTAGTACCAGCTGTCATATTCGGGGATATGGACGTCTGGGGCCAAGGGACCACGGTCACCGTCTCCTCAGGTCAAACC
#1334 dh3
......@@ -208,7 +214,7 @@ GCCAGGGATACTTCGTAGCTATGCTATGCACTGGGTCCGCCAGGCTCCAGGCAAGGGGCTGGAGTGGGTGGCAGTTATAT
GGCAATTCATCCTTCGTAGCTATGGCATGCACTGGGTCCGCCAGGCTCCAGGCAAGGGGCTGGAGTGGGTGGCAGTTATATCATATGATGGAAGTAATAAATACTATGCAGACTCCGTGAAGGGCCGATTCACCATCTCCAGAGACAATTCCAAGAACACGCTGTATCTGCAAATGAACAGCCTGAGAGCTGAGGACACGGCTGTGTATTACTGTGCGAAAGAGGGGATGACTACAGTAACTACCAATTACTACTACTACTACGGTATGGACGTCTGGGGCCAAGGGACCACGGTCACCGTCTCCTCAGGTA
#gos268 dh2
>IGHD2-2*01 5/11/11 IGHJ6*02 [IGH+] BUG
>(IGHD2-2*01, IGHD2-2*02) 5/11/11 IGHJ6*02 [IGH+]
GGGTTTCGGACAAAAACCCCCTGGAAATCATAGTATCAGCAGGAGAACTAGCCAGAGACAGCAAGAGGGGACTCAGTGACTCCCGCGGGGACAGGAGGATTTTGTGGGGGCTCGTGTCACTGTGAGGATATTGTAGTAGTACCAGCTGCTCGGGGGCCAGTTACTACGGTATGGACGTCTGGGGCCAAGGGACCACGGTCACCGTCTCCTCAGGT
#gos268 dh4
......@@ -260,7 +266,7 @@ GCTTGGAATCCTTCGTAGCTATAGCATGAACTGGGTCCGCCAGGCTCCAGGGAAGGGGCTGGAGTGGGTCTCATCCATTA
TTCCACAGACCCTCACGCTGACCTGCACCTTCTCTGGGTTCTCACTCAGCACTAGTGGAGTGGGTGTGGGCTGGATCCGTCAGCCCCCAGGAAAGGCCCTGGAGTGGCTTGCACTCATTTATTGGAATGATGATAAGCGCTACAGCCCATCTCTGAAGAGCAGGCTCACCATCACCAAGGACACCTCCAAAAACCAGGTGGTCCTTACAATGACCAACATGGACCCTGTGGACACAGCCACATATTACTGTGCACTCCTTTGAAGCAGCTCGTCCGGACTACTGGGGCCAGGGAACCCTGGTCACCGTCTCGTCAGGTAAAA
#kw222 vh3
>IGHV3-13*01 6/9/12 IGHD2-2*01 3/4/0 IGHJ6*02 [IGH] BUG
>IGHV3-13*01 6/9/12 (IGHD2-2*01, IGHD2-2*02) 3/4/0 IGHJ6*02 [IGH] BUG
CGCATCCTTCGTAGCTACGACATGCACTGGGTCCGCCAAGCTACAGGAAAAGGTCTGGAGTGGGTCTCAGCTATTGGTACTGCTGGTGACACATACTATCCAGGCTCCGTGAAGGGCCGATTCACCATCTCCAGAGAAAATGCCAAGAACTCCTTGTATCTTCAAATGAACAGCCTGAGAGCCGGGGACACGGCTGTGTATTACTGTGCCCTCCGACCTAGTACCAGCTGCTATCCCTATTACTACTACTACTACGGTATGGACGTCTGGGGCCAAGGGACCACGGTCACCGTCTCCTCAGGT
#kw221 vh3
......
......@@ -50,10 +50,10 @@ void testOnlineBioReaderMaxNth() {
void testFastaNbSequences() {
TAP_TEST_EQUAL(nb_sequences_in_file("../../germline/homo-sapiens/IGHV.fa"), 349, TEST_FASTA_NB_SEQUENCES, "ccc");
TAP_TEST_EQUAL(nb_sequences_in_file("../../germline/homo-sapiens/IGHV.fa"), 357, TEST_FASTA_NB_SEQUENCES, "ccc");
int a1 = approx_nb_sequences_in_file("../../germline/homo-sapiens/IGHV.fa");
TAP_TEST(a1 >= 345 && a1 <= 355, TEST_FASTA_NB_SEQUENCES, "");
TAP_TEST(a1 >= 350 && a1 <= 370, TEST_FASTA_NB_SEQUENCES, "");
int a2 = nb_sequences_in_file("data/Stanford_S22.fasta", true);
TAP_TEST(a2 >= 13100 && a2 <= 13200, TEST_FASTA_NB_SEQUENCES, "");
......
......@@ -63,7 +63,7 @@ AACGGTGTAGTGGATGATTCACAGTTGCCTAAGGATCGATTTTCTGCAGAGAGGCTCAAAGGAGTAGACTCCACTCTCAA
# 0000-nck-TRB+
>TRBD2*02 8/10/2 TRBJ2-7*01 [TRB+]
>TRBD2 8/10/2 TRBJ2-7*01 [TRB+]
CTGCGCTTCCTGCCGCTGCCcaGTGGTTGGGGGAGGGGGACtaGCAGGGAGGAAACATTTTTGTATcaTGGTGTAACATTGTGGGGACTAGTGTCAGTCCCCCTACGAGCAGTACTTCGGGCCGGGCACCAGGCTCACGGTTACAGGTAAGA
......
{
"ref": "http://www.vidjil.org/germlines/germline-52.tar.gz",
"ref": "http://www.vidjil.org/germlines/germline-58.tar.gz",
"species": "Homo sapiens",
"species_taxon_id": 9606,
......
Markdown is supported
0% or
You are about to add 0 people to the discussion. Proceed with caution.
Finish editing this message first!
Please register or to comment