Commit 755b9710 authored by Thonier Florian's avatar Thonier Florian Committed by Mikaël Salson

doc/analysis-example.vidjil; add a clone from unexpected locus

link to #3512
parent 1d3f3a92
......@@ -45,6 +45,9 @@
],
"IGH": [
1632, 0
],
"ERG": [
288, 0
]
}
},
......@@ -1754,6 +1757,20 @@
447
],
"id": "ACTGYCCYTGTGCYGYGYTGYGGYAAYCGCY"
},
{
"germline": "ERG",
"sequence": "GTCTAACTCAGAAGCATCTCACGGTAAGGAAAAATTTTCCTTTCTGATGAAAATCAAATGTAAAACACTGTAACAAAAAAAGAGGACATTTCCAATTATTTAAAAAATGGATACCTCCCACTTTTTCCAAAAGTAAAAAAAAAAAAAGAATTTGGAATGGCTTACCAAACAGATTACAATAAATCATAGTCTAAGATAAACATCTGAAGCACTTGGGGCTTTCTGGTGCGTGAGGCTAGAGTGAAGAAAGGGAGAGGGTGGCTGTGGACCACCGAAGCTGA",
"top": 100,
"name": "ERG-4F 0/TCT/0 ERG-Seq-R",
"seg_stat": {
"3": 9832
},
"reads": [
288
],
"id": "AAATCATAGTCTAAGATAAACATCTGAAGCACTTGGGGCTTTCTGGTGCG"
}
],
"clusters": [],
......
Markdown is supported
0% or
You are about to add 0 people to the discussion. Proceed with caution.
Finish editing this message first!
Please register or to comment