Commit 751283ee authored by Thonier Florian's avatar Thonier Florian

Update functionnal browser tests

Link to #3512
parent 3dab4df3
Pipeline #59066 failed with stages
in 3 minutes and 44 seconds
......@@ -199,7 +199,7 @@ class TestMultilocus < BrowserTest
$b.clone_in_scatterplot('77').click
$b.clone_in_scatterplot('25').click(:control)
$b.clone_in_scatterplot('88').click(:control)
$b.clone_in_scatterplot('50').click(:control)
$b.clone_in_scatterplot('90').click(:control)
$b.menu_item_export_fasta.click
assert ( $b.window(:title => "").exists? ) , ">> fail opening fasta export "
......
......@@ -49,6 +49,7 @@
"ERG": [
362, 0
]
}
},
"samples": {
......@@ -100,7 +101,8 @@
},
"reads": [
606
],
],
"normalized_reads": [909],
"seg_stat": [
{
"1": 217,
......@@ -124,6 +126,21 @@
],
"id": "YTGTGCYGYGYCCCYYGGYYAAAYCCTTGY"
},
{
"germline": "TRB",
"sequence": 0,
"top": 50,
"seg_stat": [
{
"1": 132,
"2": 230
}
],
"reads": [
362
],
"id": "CTGTGCYGYGYYCTGGGGGGTYCYTYAYGYC"
},
{
"germline": "TRB",
"sequence": 0,
......@@ -1587,9 +1604,9 @@
"id": "YTGTGCYGYGYCGYYGGYYYYAGYTYTT"
},
{
"germline": "TRB",
"name": "TRBV29*01 -3/2/-4 TRBD1*01 -1/1/-7 TRBJ2-7*01",
"sequence": "YYGGGYYACGYAYAGCGGYGYTTYYCCTYTYTGYTYTGCYAAAYAACYYYYTGTGYCTYTGTGCYGYGTTYCYGGGGGGYAYGYCTYGGYCCGGYCYGGCYACGGTTTYYGYYTYYAATGTYCYYCCYAG",
"germline": "ERG",
"name": "ERG-4F 0/TCT/0 ERG-Seq-R",
"sequence": "GTCTAACTCAGAAGCATCTCACGGTAAGGAAAAATTTTCCTTTCTGATGAAAATCAAATGTAAAACACTGTAACAAAAAAAGAGGACATTTCCAATTATTTAAAAAATGGATACCTCCCACTTTTTCCAAAAGTAAAAAAAAAAAAAGAATTTGGAATGGCTTACCAAACAGATTACAATAAATCATAGTCTAAGATAAACATCTGAAGCACTTGGGGCTTTCTGGTGCGTGAGGCTAGAGTGAAGAAAGGGAGAGGGTGGCTGTGGACCACCGAAGCTGA",
"top": 2,
"seg": {
"5end": 94,
......@@ -1742,24 +1759,10 @@
447
],
"id": "ACTGYCCYTGTGCYGYGYTGYGGYAAYCGCY"
},
{
"germline": "ERG",
"sequence": "GTCTAACTCAGAAGCATCTCACGGTAAGGAAAAATTTTCCTTTCTGATGAAAATCAAATGTAAAACACTGTAACAAAAAAAGAGGACATTTCCAATTATTTAAAAAATGGATACCTCCCACTTTTTCCAAAAGTAAAAAAAAAAAAAGAATTTGGAATGGCTTACCAAACAGATTACAATAAATCATAGTCTAAGATAAACATCTGAAGCACTTGGGGCTTTCTGGTGCGTGAGGCTAGAGTGAAGAAAGGGAGAGGGTGGCTGTGGACCACCGAAGCTGA",
"top": 50,
"name": "ERG-4F 0/TCT/0 ERG-Seq-R",
"seg_stat": {
"3": 9832
},
"reads": [
362
],
"id": "AAATCATAGTCTAAGATAAACATCTGAAGCACTTGGGGCTTTCTGGTGCG"
}
],
"clusters": [],
"reads-distribution-100": [
219648
]
}
\ No newline at end of file
}
Markdown is supported
0% or
You are about to add 0 people to the discussion. Proceed with caution.
Finish editing this message first!
Please register or to comment