Commit 7139afc6 authored by Mikaël Salson's avatar Mikaël Salson

format-analysis.org: Good example with positions starting at 1

parent 8bcd8aa6
......@@ -55,7 +55,7 @@ Note that other elements could be added by some program (such as =tag= or =clust
"top": 1,
"seg":
{
"5": "TRGV5*01", "5start": 0, "5end": 86,
"5": "TRGV5*01", "5start": 1, "5end": 86,
"3": "TRGJ1*02", "3start": 89, "3end": 118,
"cdr3": { "start": 77, "stop": 104, "seq": "gccacctgggccttattataagaaactc" }
}
......@@ -102,7 +102,7 @@ and 'IMGT clonotype (AA) or (nt)' could also be used by some programs).
"top": 1,
"seg":
{
"5": "TRGV5*01", "5start": 0, "5end": 86,
"5": "TRGV5*01", "5start": 1, "5end": 86,
"3": "TRGJ1*02", "3start": 89, "3end": 118
}
},
......@@ -118,7 +118,12 @@ and 'IMGT clonotype (AA) or (nt)' could also be used by some programs).
"sequence": "ATACAGA",
"reads": [ 521, 42 ],
"germline": "TRG",
"top": 3
"top": 3,
"seg":
{
"5start": 1, "5end": 100,
"3start": 101, "3end": 200
}
}
]
}
......
Markdown is supported
0% or
You are about to add 0 people to the discussion. Proceed with caution.
Finish editing this message first!
Please register or to comment