Commit 6f3027e2 authored by Thonier Florian's avatar Thonier Florian

fuse.py: update a clone for doctest on axis

Link to #3944
parent 540a3ab0
......@@ -857,8 +857,33 @@ seg_w7 = {
"aa": "ATDAG#SGTYKYI",
"start": 96,
"stop": 133
}
},
"evalue": {
"val": "1.180765e-43"
},
"evalue_left": {
"val": "1.296443e-47"
},
"evalue_right": {
"val": "1.180635e-43"
},
"junction": {
"aa": "CQQSYSTPYTF",
"productive": True,
"start": 93,
"stop": 136
},
},
"germline": "TRA",
"_average_read_length": [
76.0
],
"_coverage": [
0.973684191703796
],
"_coverage_info": [
"74 bp (97% of 76.0 bp)"
],
"sequence": "GTGGAAGATTAAGAGTCACGCTTGACACTTCCAAGAAAAGCAGTTCCTTGTTGATCACGGCTTCCCGGGCAGCAGACACTGCTTCTTACTTCTGTGCTACGGACGCCGGGGCTCAGGAACCTACAAATACATCTTTGGAACAG",
"top": 26
}
......
Markdown is supported
0% or
You are about to add 0 people to the discussion. Proceed with caution.
Finish editing this message first!
Please register or to comment