Commit 6f22700a authored by Thonier Florian's avatar Thonier Florian

segmenter & test: now first_clone cannot be setted as NaN value

link to #2041
parent c9959e4b
......@@ -702,6 +702,10 @@ Segment.prototype = {
* This one can be changed when we deselect some clone into the segmenter
**/
set_first_clone : function(cloneID) {
if (cloneID === NaN){
console.error( "Nan error")
return
}
this.first_clone = cloneID;
},
......
......@@ -175,10 +175,10 @@ QUnit.test("segt", function (assert) {
m.initClones();
var segment = new Segment("segment",m);
segment.init();
m.select(2)
segment.addGermlineToSegmenter("IGHD1-1*01","IGH");
assert.equal(segment.sequence["IGHD1-1*01"].seq.join("").toUpperCase(), "GGGCGCCGGGGCAGATTCTGAACAGCCCCGAGTCACGGTGGGTACAACTGGAACGAC")
assert.equal(segment.sequence["IGHD1-1*01"].is_clone, false);
m.select(2)
segment.addToSegmenter(2);
segment.add_all_germline_to_segmenter();
// segment.updateElem()
......
Markdown is supported
0% or
You are about to add 0 people to the discussion. Proceed with caution.
Finish editing this message first!
Please register or to comment