Commit 692c8634 authored by Mikaël Salson's avatar Mikaël Salson

Merge branch 'feature-a/airr-no-clone-id' into 'dev'

Feature a/airr no clone

See merge request !345
parents b118541a 4243edae
Pipeline #47250 passed with stages
in 56 minutes and 20 seconds
......@@ -156,7 +156,6 @@ map <string, string> CloneOutputAIRR::fields()
fields["duplicate_count"] = string_of_int(reads());
fields["sequence_id"] = get("id");
fields["clone_id"] = get("id");
fields["sequence"] = get("sequence");
fields["v_call"] = get(KEY_SEG, "5", "name");
fields["d_call"] = get(KEY_SEG, "4", "name");
......@@ -191,7 +190,6 @@ void SampleOutputAIRR::out(ostream &s)
"sequence_alignment",
"germline_alignment",
"v_cigar", "d_cigar", "j_cigar",
"clone_id"
};
......
......@@ -36,8 +36,8 @@ $ Two clones are productive, no clone is labeled as non-productive
$ v_call for 2 clones (-z 2)
2:IGHV
$ First clone window appears third times (clone_id, sequence_id, sequence)
w3:TATTACTGTACCCGGGAGGAACAATATAGCAGCTGGTACTTTGACTTCTG
$ First clone window appears two times (sequence_id, sequence)
w2:TATTACTGTACCCGGGAGGAACAATATAGCAGCTGGTACTTTGACTTCTG
$ Junction of the first clone appears once, but CDR3 twice (it is also included in the junction)
1:CTREEQYSSWYFDFW
......
Markdown is supported
0% or
You are about to add 0 people to the discussion. Proceed with caution.
Finish editing this message first!
Please register or to comment