Commit 6596b1b1 authored by Mathieu Giraud's avatar Mathieu Giraud

should-vdj-tests: add newlines at the end of some .should-vdj.fa files

parent 4cdd6cd3
......@@ -25,4 +25,4 @@ AgcgggtggtgatggcaaagtgccaaggaaagggaaaaaggaagaagagggtttttatactgatgtgtCCAGGGACTGGG
AgcgggtggtgatggcaaagtgccaaggaaagggaaaaaggaagaagagggtttttatactgatgtgtttCattgtgCCTTCCTACTACGcacagtgctacaaaacctacagagacctgtacaaaaactgcaggggcaaaagtgccatttccctgggatatcctcaccctgggtcccatgcctcaggagacaaacacagcaagcagcttccctc
>TRDV2 0/7/0 TRDD3 [TRD+]
GAAtcGAtAttGCAAAGAACCtGGCtGtACttAAGatACttGCACCAtCAGaGaGaGAtGAAGgGtCttACtACtGtGCCtGtGACACCCCCCtGTACtGGGGGAtACGCACAGtGCtACAAAACCtACAGAGACCtGTACAAAAACtGCAGGGGCAAAAGtGCCATttCCCtGGGAtAtCCtCACCCtGGGTCCCAA
\ No newline at end of file
GAAtcGAtAttGCAAAGAACCtGGCtGtACttAAGatACttGCACCAtCAGaGaGaGAtGAAGgGtCttACtACtGtGCCtGtGACACCCCCCtGTACtGGGGGAtACGCACAGtGCtACAAAACCtACAGAGACCtGTACAAAAACtGCAGGGGCAAAAGtGCCATttCCCtGGGAtAtCCtCACCCtGGGTCCCAA
>TRDV2*02 3/TGGTGG/3 TRDD3*01 3/CCCACCTCACTTG/3 TRAJ29*01 [TRA+D]
ATACCGAGAAAAGGACATCTATGGCCCTGGTTTCAAAGACAATTTCCAAGGTGACATTGATATTGCAAAGAACCTGGCTGTACTTAAGATACTTGCACCATCAGAGAGAGATGAAGGGTCTTACTACTGTGCCTGTGTGGTGGGGGGGATCCCACCTCACTTGATTCAGGAAACACACCTCTTGTCTTTGGAAAGGGCACAAGACTTTCTGTGATTGCAAGTAAGTGTTTCTAGCCATCCTTGATTTTGATCAGCAATGGCTTCTTCCCTTGAATTATTTTTCAGTGTACCTAGAATGCTTTTGCC
\ No newline at end of file
ATACCGAGAAAAGGACATCTATGGCCCTGGTTTCAAAGACAATTTCCAAGGTGACATTGATATTGCAAAGAACCTGGCTGTACTTAAGATACTTGCACCATCAGAGAGAGATGAAGGGTCTTACTACTGTGCCTGTGTGGTGGGGGGGATCCCACCTCACTTGATTCAGGAAACACACCTCTTGTCTTTGGAAAGGGCACAAGACTTTCTGTGATTGCAAGTAAGTGTTTCTAGCCATCCTTGATTTTGATCAGCAATGGCTTCTTCCCTTGAATTATTTTTCAGTGTACCTAGAATGCTTTTGCC
......@@ -10,4 +10,4 @@ ATACCGAGAAAAGGACATCTATGGCCCTGGTTTCAAAGACAATTTCCAAGGTGACATTGATATTGCAAAGAACCTGGCTG
# 12345678
>TRDD2*01 13//8 TRAJ29*01 [TRA+D]
AGCGGGTGGTGATGGCAAAGTGCCAAGGAAAGGGAAAAAGGAAGAAGAGGGTTTTTATACTGATGTGTTTCATGGAAGGGACACCTCTTGTCTTTGGAAAGGGCACAAGACTTTCTGTGATTGCAAGTAAGTGTTTCTAGCCATCCTTGATTTTGATCAGCAATGGCTTCTTCCCTTGAATTATTTTTCAGTGTACCTAGAATGCTTTTGCC
\ No newline at end of file
AGCGGGTGGTGATGGCAAAGTGCCAAGGAAAGGGAAAAAGGAAGAAGAGGGTTTTTATACTGATGTGTTTCATGGAAGGGACACCTCTTGTCTTTGGAAAGGGCACAAGACTTTCTGTGATTGCAAGTAAGTGTTTCTAGCCATCCTTGATTTTGATCAGCAATGGCTTCTTCCCTTGAATTATTTTTCAGTGTACCTAGAATGCTTTTGCC
>IGHD6-13*01_8/TCCCCCCCCCCT/6_IGHJ1*01__IGH+
ATACGAGATATGGACAGATTACGGTAGCAGAGACTTGGTCTTGACCCCAGCAAGGGAAGGCCCCCAAACAGACCAGGAGGTTTCTGAAGGTGTCTGTGTCACAGTGGGGTATAGCAGCA
TCCCCCCCCCCT
TACTTCCAGCACTGGGGCCAGGGCACCCTGGTCACCGTCTCCTCAGGTAAG
\ No newline at end of file
TACTTCCAGCACTGGGGCCAGGGCACCCTGGTCACCGTCTCCTCAGGTAAG
>IGKV3D-20*01 3/AGGGG/11 KDE [IGK+]
CCCAGGCTCCTCATCTATGATGCATCCAGCAGGGCCACTGGCATCCCAGACAGGTTCAGTGGCAGTGGGTCTGGGACAGACTTCACTCTCACCATCAGCAGACTGGAGCCTGAAGATTTTGCAGTGTATTACTGTCAGCAGTATGGTAGCTCACC
AGGGG
GGCAGCCCAGGGCGACTCCTCATGAGTCTGCAGCTGCATTTTTGCCATATCCACTATTTGGAGTCTGACCTCCCTAGGAAGCCTCCCTGCTCCCTAGGACAACCTGCTCTGACCTCTGAGG
\ No newline at end of file
GGCAGCCCAGGGCGACTCCTCATGAGTCTGCAGCTGCATTTTTGCCATATCCACTATTTGGAGTCTGACCTCCCTAGGAAGCCTCCCTGCTCCCTAGGACAACCTGCTCTGACCTCTGAGG
>TRDD2*01 0/CGAG/3 TRDD3*01 [TRD+]
AGCGGGTGGTGATGGCAAAGTGCCAAGGAAAGGGAAAAAGGAAGAAGAGGGTTTTTATACTGATGTGTTTCATTGTGCCTTCCCACCGAGGGGGGATACGCACAGTGCTACAAAACCTACAGAGACCTGTACAAAAACTGCAGGGGCAAAAGTGCCATTTCCCTGGGATATCCTCACCCTGGGTCCCA
\ No newline at end of file
AGCGGGTGGTGATGGCAAAGTGCCAAGGAAAGGGAAAAAGGAAGAAGAGGGTTTTTATACTGATGTGTTTCATTGTGCCTTCCCACCGAGGGGGGATACGCACAGTGCTACAAAACCTACAGAGACCTGTACAAAAACTGCAGGGGCAAAAGTGCCATTTCCCTGGGATATCCTCACCCTGGGTCCCA
>Intron 5/CGCCA/4 KDE [IGK+]
CGTGGCACCGCGAGCTGTAGACAGAGCCGCGGTCTTTCTCGATTGAGTGGCTTTGGTGGCCATGCCACCGCGCTCTTGGGGCAGCCGCCTTGCCGCTAGTGGCCGTGGCCACCCTGTGTCTGCCCGATTAATGCTGCCGTAGCCAGCTTTCCCGCCACCCTAGTGGCAGCCCAGGGCGACTCCTCATGAGTCTGCAGCTGCATTTTTGCCATATCCACTATTTGGAGTCTGACCTCCCTAGGAAGCCTCCCTGCTCCCTAGGACAACCTGCTCTGACCTCTGAGG
\ No newline at end of file
CGTGGCACCGCGAGCTGTAGACAGAGCCGCGGTCTTTCTCGATTGAGTGGCTTTGGTGGCCATGCCACCGCGCTCTTGGGGCAGCCGCCTTGCCGCTAGTGGCCGTGGCCACCCTGTGTCTGCCCGATTAATGCTGCCGTAGCCAGCTTTCCCGCCACCCTAGTGGCAGCCCAGGGCGACTCCTCATGAGTCTGCAGCTGCATTTTTGCCATATCCACTATTTGGAGTCTGACCTCCCTAGGAAGCCTCCCTGCTCCCTAGGACAACCTGCTCTGACCTCTGAGG
>IGKV1-5*03 9/4/1 IGKJ1*01 [IGK]
CTCCTGCTACTCTGGCTCCCAGGTGCCAAATGTGACATCCAGATGACCCAGTCTCCTTCCACCCTGTCTGCGTCTGTAGGAGACAGAGTCACCATCACCTGCCGGGCCAGTCAGAGTATTAATAACAACTTGGCCTGGTATCAGGAGAAGCCAGGGAAAGCCCCTAAGGTCCTGATCTATAAGGCGTCTAGTTTAGAAAGTGGGGTCCCATCAAGGTTCAGCGGCAGTGGATCTGGGACAGAATTCACTCTCACCATCAGCAGCCTGCAGCCTGATGATTTTGCAACCTATTACTGCCAACAATATAATAGACTTTGGACGTTCGGCCAAGGGACCAAGGTGGAAGTCAAACGAACTGTGGCTGCACCATCT
\ No newline at end of file
CTCCTGCTACTCTGGCTCCCAGGTGCCAAATGTGACATCCAGATGACCCAGTCTCCTTCCACCCTGTCTGCGTCTGTAGGAGACAGAGTCACCATCACCTGCCGGGCCAGTCAGAGTATTAATAACAACTTGGCCTGGTATCAGGAGAAGCCAGGGAAAGCCCCTAAGGTCCTGATCTATAAGGCGTCTAGTTTAGAAAGTGGGGTCCCATCAAGGTTCAGCGGCAGTGGATCTGGGACAGAATTCACTCTCACCATCAGCAGCCTGCAGCCTGATGATTTTGCAACCTATTACTGCCAACAATATAATAGACTTTGGACGTTCGGCCAAGGGACCAAGGTGGAAGTCAAACGAACTGTGGCTGCACCATCT
Markdown is supported
0% or
You are about to add 0 people to the discussion. Proceed with caution.
Finish editing this message first!
Please register or to comment