Commit 57832e97 authored by Mikaël Salson's avatar Mikaël Salson

0000-nck-TRB.should-vdj.fa: Bad assignation relying on homopolymer

The former assignation was assuming the following alignment at the end of the V:
GCTTTAGC
|||| |||
GCTT-AGC
by considering that the TTT aligns with TT as it is an homopolymer.

This could be, however since those sequence comes from an Illumina, it is
highly unlikely.

Even when forbidding homopolymers this sequence is still badly assigned. The
reason why is unknown (see #2904).
parent c71e9fb7
......@@ -6,7 +6,11 @@
GAGGGTACCACTGACAAAGGAGAAGTCCCCAATGGCTACAATGTCTCCAGATTAAACAAACGGGAGTTCTCGCTCAGGCTGGAGTCGGCTGCTCCCTCCCAGACATCTGTGTACTTCTGTGCCAGCAAGGTGAGTCCCCCTACGAGCAGTACTTCGGGCCGG
# AGC commun aux deux segments
>TRBV7-2*02 0/0/3 TRBJ2-3*01 [TRB] {CASSFSTDTQYF}
# read: GTGTATCTCTGTGCCAGCAGCTTTAGCACAGATACGCAGTATTTTGGCCC
# ||||||||||||||||||||||| ||||||||||||||||||||
# TRBV7-2*02 GTGTATCTCTGTGCCAGCAGCTTAGC
  • The former assignation was assuming the following alignment at the end of the V:

    GCTTTAGC

    |||| ||| GCTT-AGC

    > by considering that the TTT aligns with TT as it is an homopolymer.
    
    Mais si on considère
    

    GCTTTAGC || ||||| GC-TTAGC

    
    est-ce que cela change quelque chose ? 
    
    
    
  • C'est assez logiquement le même score qu'avec l'insertion à droite. Mais je me suis lourdé dans mes calculs de score : ça reste plus intéressant de faire la délétion au milieu (18) que de supprimer les 3 derniers nucléotides (13).

    Du coup le comportement est cohérent. Je peux quand même laisser la seconde désignation comme une alternative possible.

Please register or sign in to reply
# TRBJ2-3*01 AGCACAGATACGCAGTATTT
>TRBV7-2*02 3/T/0 TRBJ2-3*01 [TRB] {CASSFSTDTQYF} BUG
TTACCCTTTACTGGTACCGGCAGAGGCTGGGGCAGGGCCTGGAGTTTTTAATTTACTTCCAAGGCAACAGTGCACCAGACAAATCAGGGCTGCCCAGTGATCGCTTCTCTGCAGAGAGGACTGGGGAATCCGTCTCCACTCTGACGATCCAGCGCACACAGCAGGAGGACTCGGCCGTGTATCTCTGTGCCAGCAGCTTTAGCACAGATACGCAGTATTTTGGCCCAGGCACCCGGCTGACAGTGCTCGGTAAGCGGG
>TRBV11-2*01 1/4/0 TRBJ2-7*01 [TRB] {CASSLGPSYEQYF}
......
# 0000-nck-TRB.should-vdj.fa.rc
>TRBV7-2*02 0/0/3 TRBJ2-3*01 [TRB]
>TRBV7-2*02 3/T/0 TRBJ2-3*01 [TRB] BUG
CCCGCTTACCGAGCACTGTCAGCCGGGTGCCTGGGCCAAAATACTGCGTATCTGTGCTAAAGCTGCTGGCACAGAGATACACGGCCGAGTCCTCCTGCTGTGTGCGCTGGATCGTCAGAGTGGAGACGGATTCCCCAGTCCTCTCTGCAGAGAAGCGATCACTGGGCAGCCCTGATTTGTCTGGTGCACTGTTGCCTTGGAAGTAAATTAAAAACTCCAGGCCCTGCCCCAGCCTCTGCCGGTACCAGTAAAGGGTAA
# 0119-lil-IGK+-TRA+D-TRD+-TRG.should-vdj.fa.rc
......
Markdown is supported
0% or
You are about to add 0 people to the discussion. Proceed with caution.
Finish editing this message first!
Please register or to comment