Commit 57516841 authored by Mikaël Salson's avatar Mikaël Salson

should-vdj-tests/igh-vdj.should-vdj.fa: Several alternatives

Sequences are short (or very short): offer several alternatives
parent fa427654
>IGHV1-18*01, IGHV7-4-1*02 0//0 IGHD1-1*01 0//0 IGHJ1*01 [IGH]
>IGHV 0//0 IGHD1-1*01 0//0 IGHJ1*01 [IGH]
actgtgcgagaga
ggtacaactggaacgac
gctgaatacttcc
>IGHV1-18*01 0//0 IGHD3-16*01 0//0 IGHJ4*01 [IGH]
>(IGHV1-18*01, IGHV1-18*04) 0//0 IGHD3-16*01 0//0 IGHJ4*01 [IGH]
agcctacatggagctgaggagcctgagatctgacgacacggccgtgtattactgtgcgagaga
gtattatgattacgtttgggggagttatgcttatacc
actactttgactactggggccaaggaaccctggtcaccgtctcctcag
# Same sequence, but with only the 20bp start of J
>IGHV1-18*01 0//0 IGHD3-16*01 0//0 IGHJ4*01 [IGH] BUG
>(IGHV1-18*01, IGHV1-18*04) 0//0 IGHD3-16*01 0//0 (IGHJ4*01, IGHJ4*02) [IGH] BUG
agcctacatggagctgaggagcctgagatctgacgacacggccgtgtattactgtgcgagaga
gtattatgattacgtttgggggagttatgcttatacc
actactttgactactggggcc
# Same sequence, but with only the 15bp start of J
>IGHV1-18*01 0//0 IGHD3-16*01 0//0 IGHJ4*01 [IGH] BUG-LOCUS
>(IGHV1-18*01, IGHV1-18*04) 0//0 IGHD3-16*01 0//0 (IGHJ4*01, IGHJ4*02) [IGH] BUG-LOCUS
agcctacatggagctgaggagcctgagatctgacgacacggccgtgtattactgtgcgagaga
gtattatgattacgtttgggggagttatgcttatacc
actactttgactactg
\ No newline at end of file
Markdown is supported
0% or
You are about to add 0 people to the discussion. Proceed with caution.
Finish editing this message first!
Please register or to comment