Commit 56e8f070 authored by Tatiana Rocher's avatar Tatiana Rocher

tests in the same format

parent 3ddff430
>TRBD2*02_8/10/2_TRBJ2-7*01 [TRB+]
>TRBD2*02 8/10/2 TRBJ2-7*01 [TRB+]
CTGCGCTTCCTGCCGCTGCCcaGTGGTTGGGGGAGGGGGACtaGCAGGGAGGAAACATTTTTGTATcaTGGTGTAACATTGTGGGGACTAGTGTCAGTCCCCCTACGAGCAGTACTTCGGGCCGGGCACCAGGCTCACGGTTACAGGTAAGA
>TRBD2*02_3/9/7_TRBJ2-1*01 [TRB+]
>TRBD2*02 3/9/7 TRBJ2-1*01 [TRB+]
CTGCGCTTCCTGCCGCTGCCcaGTGGTTggggGAGGGGGACtaGCAGGGAGGAAACATTTTTGTATATGGTGTAACATTGTGGGGACTAGCGGGAAGTAGGAGGAATGAgCAGTTCTTCGGGCCAGGGACACGGCTCACCGTGCTAGGTAAGAAGG
>TRBD2*01_2/26/2_TRBJ2-3*01 [TRB+]
>TRBD2*01 2/26/2 TRBJ2-3*01 [TRB+]
CTGCGCTTCCTGCCGCTGCCcaGTGGTTGGGGGAGGGGGACtaGCAGGGAGGAAACATTTTTGTATATGGTGTAACATTGTGGGGACTAGCGGGGGAGAAATTTCCAGTGTCACCTCCGTTACACAGATACGCAGTATTTTGGCCCAGGCACCCGGCTGACAGTGCTCGGTAAGCGGG
###############################"
>TRBD1_0/14/0_TRBJ1-5 [TRB+]
>TRBD1 0/14/0 TRBJ1-5 [TRB+]
CCTGAgGAcGTGCCTGGAGGTGAGAAGGAAGCCCCCGGCCTGGTCCATACCCCACCACCAACTTGCATAATGGGGGGTGATGTCACCCACCCTCCACTCCCCTCAAAGGAGCAGCTGCTCTGGTGGTCTCTCCCAGGCTCTGGGGGCGGACCCATGGGAGGGGCTGTTTTTGTACAAAGCTGTAACATTGTGGGGACAGGGGGCCCTTTTTTTCTTTATAGCAATCAgCCCCAGCATTTTGGTGATGGGACTCGACTCTCCATCCTAGgtaagttggcagaatcaggg
>TRBD1_2/6/2_TRBJ1-3*01 [TRB+]
>TRBD1 2/6/2 TRBJ1-3*01 [TRB+]
CCCACCACCAACttGcAtaacGgggggtGatgtCACCCaCCCtCCaCtCCCCtCAAtggAGCtGCtGCtCtGGtggtCtCtCCCagGCtCtGgggGcggAcCCACGGGaggggCtGtttttGtaCAAaGCtgtAACAttGtGgggAcAGGGGaaaaaaCtgGaAaCACCAtatattttGGaGaggGaaGttGGCtCACtGt
>TRBD2*02_3/5/4_TRBJ2-7*02 [TRB+]
>TRBD2*02 3/5/4 TRBJ2-7*02 [TRB+]
CTGCGCTTCCTGCCGCTGCCCaGTGGTTGGGGGAGGGGGACtaGCAGGGAGGAAACATTTTTGTATCATGGTGTAACATTGTGGGGACTAGCGGGATcATTTACGAGCAGTACGTCGGGCCGGGCACCAGGCTCACGGTTACaGGTAAGA
......@@ -10,14 +10,14 @@ AACGGTGTAGTGGATGATTCACAGTTGCCTAAGGATCGATTTTCTGCAGAGAGGCTCAAAGGAGTAGACTCCACTCTCAA
##############################################
# Erreur de nomage a arbitrer (sanger ET vidjil faux ? )
>TRBV10-2*01_4/7/4_TRBJ1-2*01 [TRB] TODO
>TRBV10-2*01 4/7/4 TRBJ1-2*01 [TRB] TODO
GCTGATATTACAGATAAAGGAgAAGTCCCCGATGGCTATGTTGTCTCCAGATCCAAGACAGAGAATtTCCCCCTCACTCTGGAGTCaGCtACCCGCTCCCAgACATCTGTGTATTTCTGCGCCaGCAGTGCCACTAgCTaTGGCTACACCTTCGGTTCGGGGACCAGGTTAACCGTTGTAGGTAAG
# verifier seq
>TRBV19*03_0/20/4_TRBJ1-5*01 [TRB]
>TRBV19*03 0/20/4 TRBJ1-5*01 [TRB]
GAGATATAGCTGAAGGGTACAGCGTCTCTCGGGAGAAGAAGGAATCCTTTCCTCTCACTGTGACATCGGCCCAAAAGAACCCGACAGCTTTCTATCTCTGTGCCAGTAGTCCCCACGGCGCCATAACGGAACAGCCCCAGCATTTTGGTGATGGGACTCGAC
>TRBV21-1_5/16/1_TRBJ2-1 [TRB]
>TRBV21-1 5/16/1 TRBJ2-1 [TRB]
AAAAACTCATCCTGTACCTTGGAGATCCAGTCCACGGAGTCAGGGGACACAGCACTGTATTTcTGTGCCAGCAGCGCCATGGAAGTCAACATCCTACAATGAGCAGTTCTTCGGGCCAGGGACACGGCTCACCGTGCTAGgtaagaaggg
......
>TRDD2_3/7/0_TRDD3 [TRD+]
>TRDD2 3/7/0 TRDD3 [TRD+]
gcgGGTGGtGATGGCAAAGTGCCAAGGAAAGGGAAAAAGGAAGAAGAGGGTTTTTATACTGATGTGTTTCATTGTGCCTTCCCCCCCCTACTGGGGGAtACGCACAGTGCTACAAAACCTACAgAGACCTGTACAAAAACTGCAGGGGCAAAAGTGCCATTTCCCTGGGATATCCTCACCCTGGGTcCcaaa
# double DD non detecte
>TRDD2*01_0/4/3_TRDD3_0/2/3_TRDJ1*01 [TRD+] TODO
>TRDD2*01 0/4/3 TRDD3 0/2/3 TRDJ1*01 [TRD+] TODO
AgcgggtggtgatggcaaagtgccaaggaaagggaaaaaggaagaagagggtttttatactgatgTGTTTCATTGTGCCTTCCTACGTGAGGGGGATACGCCCCGATAAACTCATCTTTGGAAAAGGAACCCGTGTGACTGTGGAAC
# double DD non detecte
>TRAV29/DV5*01_3/8/3_TRDD2_1/0/3_TRDD3_0/0/2_TRDJ1 [TRD+] TODO
>TRAV29/DV5*01 3/8/3 TRDD2 1/0/3 TRDD3 0/0/2 TRDJ1 [TRD+] TODO
cattAggtAAAAATGaagatGGAAGATTCACTGTCTTCTTAAACAAAAGTGCCAAGCACCtctcTctGCACATTGTGCCCTCCCAGCCTGGAGACTCTGCAGTGTACTTCTGTGCAGCAACACCGAGATCCTAGGGGGATACgACCGATAAACTCATCTTTGGAAAAGGAACCCGTGTGACTGTGgAACa
######################################
# double DD non detecte
>TRDV1_2/7/2_TRDD2_0/3/0_TRDD3_3/6/0_TRDJ1 [TRD+] TODO
>TRDV1 2/7/2 TRDD2 0/3/0 TRDD3 3/6/0 TRDJ1 [TRD+] TODO
CAAAAAGTGGTCGCTATTCTGTCAACTTCAAGAAAGCAGCGAAATCCGTCGCCTTAACCATTTCAGCCTTACAGCTAGAAGATTCAGCAAAGTACTTTTGTGCTCTTGGGGAATCTCGATTTCCTACCGTACTGGGGGATCTCGGGACACCGATAAACTCATCTTTGGAAAAGGAACCCGTGTGACTGTGGAAC
>TRDD2_1/3/15_TRDD3 [TRD+]
>TRDD2 1/3/15 TRDD3 [TRD+]
AgcgggtggtgatggcaaagtgccaaggaaagggaaaaaggaagaagagggtttttatactgatgtgtttCattgtgCCTTCCTATGGcagtgctacaaaacctacagagacctgtacaaaaactgcaggggcaaaagtgccatttccctgggatatcctcaccctgggtcccatgcctcaggagacaaacacagcaagcagcttccctc
#double DD non detecte
>TRDD2_18/6/0_TRDD3_5/5/0_TRDJ1 [TRD+] TODO
>TRDD2 18/6/0 TRDD3 5/5/0 TRDJ1 [TRD+] TODO
AgcgggtggtgatggcaaagtgccaaggaaagggaaaaaggaagaagagggtttttatactgatgtgtCCAGGGACTGGGGGCCAGTACACCGATAAACTCATCTTTGGAAAAGGAACCCGTGTGACTGTGGAAC
>TRDD2_0/0/9_TRDD3 [TRD+]
>TRDD2 0/0/9 TRDD3 [TRD+]
AgcgggtggtgatggcaaagtgccaaggaaagggaaaaaggaagaagagggtttttatactgatgtgtttCattgtgCCTTCCTACTACGcacagtgctacaaaacctacagagacctgtacaaaaactgcaggggcaaaagtgccatttccctgggatatcctcaccctgggtcccatgcctcaggagacaaacacagcaagcagcttccctc
>TRDV2_0/7/0_TRDD3 [TRD+]
GAAtcGAtAttGCAAAGAACCtGGCtGtACttAAGatACttGCACCAtCAGaGaGaGAtGAAGgGtCttACtACtGtGCCtGtGACACCCCCCtGTACtGGGGGAtACGCACAGtGCtACAAAACCtACAGAGACCtGTACAAAAACtGCAGGGGCAAAAGtGCCATttCCCtGGGAtAtCCtCACCCtGGGTCCCAA
>TRDV2 0/7/0 TRDD3 [TRD+]
GAAtcGAtAttGCAAAGAACCtGGCtGtACttAAGatACttGCACCAtCAGaGaGaGAtGAAGgGtCttACtACtGtGCCtGtGACACCCCCCtGTACtGGGGGAtACGCACAGtGCtACAAAACCtACAGAGACCtGTACAAAAACtGCAGGGGCAAAAGtGCCATttCCCtGGGAtAtCCtCACCCtGGGTCCCAA
\ No newline at end of file
>TRDV1*01_0/0/3_TRDD3_4/11/0_TRDJ1*01 [TRD]
>TRDV1*01 0/0/3 TRDD3 4/11/0 TRDJ1*01 [TRD]
CAAAAAGTGGTCGCTATTCTGTCAACTTCAAGAAAGCAGCGAAATCCGTCGCCTTAACCATTTCAGCCTTACAGCTAGAAGATTCAGCAAAGTACTTTTGTGCTCTTGGGGAACTAGGGGACTGGTCCCCTTACACCGATAAACTCATCTTTGGAAAAGGAACCCGTGTGACTGTGGAAc
>TRAV29/DV5*01_0/9/0_TRDD3_3/9/2_TRDJ1*01 [TRD]
>TRAV29/DV5*01 0/9/0 TRDD3 3/9/2 TRDJ1*01 [TRD]
GAtAAAAATGAAGatGGAAGaTTcaCTGTCTTCTTAAAcAAAAGTGCcaAGCACCTCTCTCTGCACATTGTGCCCTCCCAGCCTGGAGACTCTGCAGTGTACTTCTGTGCAGCAAGCGCGAATCCTGACTGGGGGATCGAGGGGGAACCGATAAACTCATCTTTGGAAAAGGAACCCGTGTGACTGTGGAACA
>TRDV1_5/14/0_TRDJ1*01 [TRD]
>TRDV1 5/14/0 TRDJ1*01 [TRD]
GCCttAcAGCtAGAAgattcAGCAAaGtACtnttGtGCtCttGGGACCCtttCCcGtGtACACCGATAAACtCAtCtttGGAAAAgGAACCCGtGtGACtGTGGAACA
################################################
>TRDV1_3/6/0_TRDD2_1/9/8_TRDJ1 [TRD]
>TRDV1 3/6/0 TRDD2 1/9/8 TRDJ1 [TRD]
TGAAATCCGTCGCCTTAACcTtTcaGCCTTACAGCTAGAAgAttcaGCAAAGTACTtTTGTGCTCTtGGGGATCCCGGCCTTCCTATGTAAgAGGAAACTCATCTTTGGAAAAgGAACCCGtGTGACtGTGGAACA
# a arbitrer
>TRDV1_7/5/0_TRDD3_2/5/4_TRDJ1 [TRD] TODO
>TRDV1 7/5/0 TRDD3 2/5/4 TRDJ1 [TRD] TODO
AAGCtAGAAgattcAGCAAaGtACttttGtGCtCttGtGCtAACtGGGGGatAAAGAtCGAtAAACtCAtCtttGGAAAAgGAACCCGtGtGACtGtGGAACA
>TRDV1_4/13/2_TRDD3_2/8/2_TRDJ1 [TRD]
>TRDV1 4/13/2 TRDD3 2/8/2 TRDJ1 [TRD]
CAAAAAGTGGTCGCTATTCTGTCAACTTCAAGAAAGCAGCGAAATCCGTCGCCTTAACCATTTCAGCCTTACAGCTAGAAGATTCAGCAAAGTACTTTTGTGCTCTTGGGGTAGCTCtTAgGAAtGGGGGATAGAtGACGGACCGATAAACtCATCTTtGGAAAAgGAACCCGtGtGACtGTGGAACa
>TRGV4_3/15/2_TRGJ1*01 [TRG]
>TRGV4 3/15/2 TRGJ1*01 [TRG]
GCGTCTTCTGTacTATGACTCCTACACCTCcaGCGTTGTGTTGGAATcaGGAATcaGCCCAGGGAAGTATGATACTTATGGAAGCACAAGGAAgAACTTGAGAATGATACTGCGAAATCTTATTGAAAATGACTCTGGAGTCTATTACTGTGCCACCTGGGATAAGGAGGGACATAAgATTATTATAAGAAACTCTTTGGCAGTGGAACAACACTGGTTGTCACAGGTA
>TRGV11_2/5/0_TRGJ1 [TRG]
>TRGV11 2/5/0 TRGJ1 [TRG]
TGGTGTACCaCTGTGCcTGCtgGaTTAGGCTCCTAGAATTATTATAAGAAACTCTTTGGCAGTGGAACAACACTGGTTGTCACAGGTaagtatcggaagaatacaacattccaaggtaatagagggaaagcaggaa
# arbitrage difficile
>TRGV10*01_14/18/1_TRGJ1*01 [TRG] TODO
>TRGV10*01 14/18/1 TRGJ1*01 [TRG] TODO
ATCCtttACcaTCaAGtCCGtAGAGAAAGAAGACAtGGCCGTttACTACtGtGCtACCGCtGGAgGtCCttACAAttAtTAtAAGAAACtCTttGGCAGTGGAACAACACtGGTtGTCACAGGTA
##########################################
# verifier TRGJ1*01 et TRGJ1-2
>TRGV11_11/12/0_TRGJ1*01 [TRG]
>TRGV11 11/12/0 TRGJ1*01 [TRG]
TCTTCCACTTCCACTTtgAAAATAAAGTTCTTAGAGAAAGAAGATGAGGTGGTGTACCaCTGTGCCTGCtaGTCACCTCATCGAATTATTATAAGA
# a arbitrer
>TRGV10-02_1/15/4_TRGJ1-1 [TRG] TODO
>TRGV10-02 1/15/4 TRGJ1-1 [TRG] TODO
TCTcaAACtCTcaCtcTcaATCCTtACcaTcaAGtCCGTAGAGAAAGAAGACATGGCCGTtTACTACtGTGCTGCGTGGGATTTGCAGCAACTtGAACTATTATAAGAAACTCTTTGGCAGTGGAACAACACTGGTTGTCACAGGTaagtatcggaagaatacaacattccaaggtaatagagggaaagcaggaa
# a arbitrer
>TRGV2_0/6/6_TRGJ1-1 [TRG] TODO
>TRGV2 0/6/6 TRGJ1-1 [TRG] TODO
AAATGACTTTGGGGTCTATTACTGTGCCACCTGGGACGGGCCGATTTTATAAGAAACTCTTTGGCAGTGGAACAACACTGGTTGTCACAGGTaagtatcggaagaatacaacattccaaggtaatagagggaaagcaggaa
>IGHV3-11*01_1/CCCCCGAGAGCCGAGGGGGGGAGAGATCCCGGGGGG/6_IGHD6-6*01_1/TCCAGCTCGTCCGGGGG/12_IGHJ4*02__IGH
>IGHV3-11*01 1/CCCCCGAGAGCCGAGGGGGGGAGAGATCCCGGGGGG/6 IGHD6-6*01 1/TCCAGCTCGTCCGGGGG/12 IGHJ4*02 [IGH]
GGGCTGGAGTGGGTTTCATACATTAGTAGTAGTGGTAGTACCATATACTACGCAGACTCTGTGAAGGGCCGATTCACCATCTCCAGGGACAACGCCAAGAACTCACTGTATCTGCAAATGAACAGCCTGAGAGCCGAGGACACGGCCGTGTATTACTGTGCGAGAGCCCCCGAGAGCCGAGGGGGGGAGAGATCCCGGGGGGAGCAGCTCGTCTCCAGCTCGTCCGGGGGACTGGGGCCAGGGAACCCTGGTCACCGTCTCCTCAGGT
>IGHV3-9*01_11/A/5_IGHD2-2*02_1/GGAATACGATATTTTGACTGGT/8_IGHJ6*03__IGH
>IGHV3-9*01 11/A/5 IGHD2-2*02 1/GGAATACGATATTTTGACTGGT/8 IGHJ6*03 [IGH]
GGGGGAGGCTTGGTACAGCCTGGCAGGTCCCTGAGACTCTCCTGTGCAGCCTCTGGATTCACCTTTGATGATTATGCCATGCACTGGGTCCGGCAAGCTCCAGGGAAGGGCCTGGAGTGGGTCTCAGGTATTAGTTGGAATAGTGGTAGCATAGGCTATGCGGACTCTGTGAAGGGCCGATTCACCATCTCCAGAGACAACGCCAAGAACTCCCTGTATCTGCAAATGAACAGTCTGAGAGCTGAGGACACGGCCTTGTATTACTGAATTGTAGTAGTACCAGCTGCTATACGGAATACGATATTTTGACTGGTTACTACTACTACATGGACGTCTGGGGCAAAGGGACCCTGGTCACCGTCTCCTCAGGT
>TRGV2*01_1/C/0_TRGJ1*02__TRG
>TRGV2*01 1/C/0 TRGJ1*02 [TRG]
GGAAGGCCCCACAGCGTCTTCAGTACTATGACTCCTACAACTCCAAGGTTGTGTTGGAATCAGGAGTCAGTCCAGGGAAGTATTATACTTACGCAAGCACAAGGAACAACTTGAGATTGATACTGCGAAATCTAATTGAAAATGACTCTGGGGTCTATTACTGTGCCACCTGGGACGGCTTATTATAAGAAACTCTTTGGCAGTGGAACAACAC
>TRGV3*01_0/CC/0_TRGJ1*01__TRG
>TRGV3*01 0/CC/0 TRGJ1*01 [TRG]
GGAAGGCCCCACAGCGTCTTCTGTACTATGACGTCTCCACCGCAAGGGATGTGTTGGAATCAGGACTCAGTCCAGGAAAGTATTATACTCATACACCCAGGAGGTGGAGCTGGATATTGAGACTGCAAAATCTAATTGAAAATGATTCTGGGGTCTATTACTGTGCCACCTGGGACAGGCCGAATTATTATAAGAAACTCTTTGGCAGTGGAACAACAC
>TRGV9*01_8/CTCACGAGGG/3_TRGJP1*01__TRG
>TRGV9*01 8/CTCACGAGGG/3 TRGJP1*01 [TRG]
CGGCACTGTCAGAAAGGAATCCGGCATTCCGTCAGGCAAATTTGAGGTGGATAGGATACCTGAAACGTCTACATCCACTCTCACCATTCACAATGTAGAGAAACAGGACATAGCTACCTACTACTGTGCCTGTCTCACGAGGGCCACTGGTTGGTTCAAGATATTTGCTGAAGGGACTAAGCTCATAGTAACTTCGCCTGGTAA
# Intron -2/0/-10 KDE ?
>Intron 2/0/9 KDE [IGK+]
CGTGGCACCGCGAGCTGTAGACAGAGCCGCGGTCTTTCTCGATTGAGTGGCTTTGGTGGCCATGCCACCGCGCTCTTGGGGCAGCCGCCTTGCCGCTAGTGGCCGTGGCCACCCTGTGTCTGCCCGATTGATGCTGCCGTAGCCAGCTTTCCTGAGTGGCAGCCCAGGGCGACTCCTCATGAGTCTGCAGCTGCATTTTTGCCATATCCACTATTTGGAGTCTGACCTCCCTAGGAAGCCTCCCTGCTCCCTAGGACAACCTGCTCTGACCTCTGAGG
>IGKV3-7*04_1/GTGGA/11_KDE__IGK+
>IGKV3-7*04 1/GTGGA/11 KDE [IGK+]
CCCAGGCTCCTCATCTATGATGCATCCACCAGGGCCACTAGCATCCCAGCCAGGTTCAGTGGCAGTGGGTCTGGGACAGACTTCACTCTCACCATCAGCAGCCTGCAGCCTGAAGATTTTGCAGTTTATTACTGTCAGCAGGATTATAACTTACCTCGTGGAGGCAGCCCAGGGCGACTCCTCATGAGTCTGCAGCTGCATTTTTGCCATATCCACTATTTGGAGTCTGACCTCCCTAGGAAGCCTCCCTGCTCCCTAGGACAACCTGCTCTGACCTCTGAGG
>TRGV2*01_9/CCCTGG/1_TRGJP1*01__TRG
>TRGV2*01 9/CCCTGG/1 TRGJP1*01 [TRG]
GGAAGGCCCCACAGCGTCTTCAGTACTATGACTCCTACAACTCCAAGGTTGTGTTGGAATCAGGAGTCAGTCCAGGGAAGTATTATACTTACGCAAGCACAAGGAACAACTTGAGATTGATACTGCGAAATCTAATTGAAAATGACTTTGGGGTCTATTACTGTGCCACCCCCTGGTACCACTGGTTGGTTCAAGATATTTGCTGAAGGGACTAAGCTCATAGTAACTTCGCCTGGTAA
# or TRGJ1*01
>TRGV5*01_0/CAGAGG/7_TRGJ1*02__TRG
>TRGV5*01 0/CAGAGG/7 TRGJ1*02 [TRG]
GGAAGGCCCCACAGCGTCTTCTGTACTATGACGTCTCCAACTCAAAGGATGTGTTGGAATCAGGACTCAGTCCAGGAAAGTATTATACTCATACACCCAGGAGGTGGAGCTGGATATTGATACTACGAAATCTAATTGAAAATGATTCTGGGGTCTATTACTGTGCCACCTGGGACAGGCAGAGGAAGAAACTCTTTGGCAGTGGAACAACAC
# or TRDV2*03
>TRDV2*01_0/C/1_TRDD3*01_4/CCGCCT/0_TRAJ29*01__TRA+D
>TRDV2*01 0/C/1 TRDD3*01 4/CCGCCT/0 TRAJ29*01 [TRA+D]
ATACCGAGAAAAGGACATCTATGGCCCTGGTTTCAAAGACAATTTCCAAGGTGACATTGATATTGCAAAGAACCTGGCTGTACTTAAGATACTTGCACCATCAGAGAGAGATGAAGGGTCTTACTACTGTGCCTGTGACACCCCTGGGGGACCGCCTGGAATTCAGGAAACACACCTCTTGTCTTTGGAAAGGGCACAAGACTTTCTGTGATTGCAAGTAAGTGTTTCTAGCCATCCTTGATTTTGATCAGCAATGGCTTCTTCCCTTGAATTATTTTTCAGTGTACCTAGAATGCTTTTGCC
# other designations are possible
>TRDV2*02_0/GGACCCTTTT/0_TRDD3*01__TRD+
>TRDV2*02 0/GGACCCTTTT/0 TRDD3*01 [TRD+]
ATACCGAGAAAAGGACATCTATGGCCCTGGTTTCAAAGACAATTTCCAAGGTGACATTGATATTGCAAAGAACCTGGCTGTACTTAAGATACTTGCACCATCAGAGAGAGATGAAGGGTCTTACTACTGTGCCTGTGACAGGACCCTTTTACTGGGGGATACGCACAGTGCTACAAAACCTACAGAGACCTGTACAAAAACTGCAGGGGCAAAAGTGCCATTTCCCTGGGATATCCTCACCCTGGGTCCCA
>TRDV2*02_6/CGGGGCCC/3_TRDD3*01_5//27_TRAJ29*01__TRA+D
>TRDV2*02 6/CGGGGCCC/3 TRDD3*01 5//27 TRAJ29*01 [TRA+D]
ATACCGAGAAAAGGACATCTATGGCCCTGGTTTCAAAGACAATTTCCAAGGTGACATTGATATTGCAAAGAACCTGGCTGTACTTAAGATACTTGCACCATCAGAGAGAGATGAAGGGTCTTACTACTGTGCCTCGGGGCCCGGGGGTTGGAAAGGGCACAAGACTTTCTGTGATTGCAAGTAAGTGTTTCTAGCCATCCTTGATTTTGATCAGCAATGGCTTCTTCCCTTGAATTATTTTTCAGTGTACCTAGAATGCTTTTGCC
\ No newline at end of file
>TRDV2*02_3/TGGTGG/3_TRDD3*01_3/CCCACCTCACTTG/3_TRAJ29*01__TRA+D
>TRDV2*02 3/TGGTGG/3 TRDD3*01 3/CCCACCTCACTTG/3 TRAJ29*01 [TRA+D]
ATACCGAGAAAAGGACATCTATGGCCCTGGTTTCAAAGACAATTTCCAAGGTGACATTGATATTGCAAAGAACCTGGCTGTACTTAAGATACTTGCACCATCAGAGAGAGATGAAGGGTCTTACTACTGTGCCTGTGTGGTGGGGGGGATCCCACCTCACTTGATTCAGGAAACACACCTCTTGTCTTTGGAAAGGGCACAAGACTTTCTGTGATTGCAAGTAAGTGTTTCTAGCCATCCTTGATTTTGATCAGCAATGGCTTCTTCCCTTGAATTATTTTTCAGTGTACCTAGAATGCTTTTGCC
\ No newline at end of file
>TRDD2*01_1/AGG/1_TRDD3*01__TRD+
>TRDD2*01 1/AGG/1 TRDD3*01 [TRD+]
AGCGGGTGGTGATGGCAAAGTGCCAAGGAAAGGGAAAAAGGAAGAAGAGGGTTTTTATACTGATGTGTTTCATTGTGCCTTCCTA
AGG
CTGGGGGATACGCACAGTGCTACAAAACCTACAGAGACCTGTACAAAAACTGCAGGGGCAAAAGTGCCATTTCCCTGGGATATCCTCACCCTGGGTCCCA
>TRGV5*01_5/GGGCCAG/2_TRGJ1*02__TRG
>TRGV5*01 5/GGGCCAG/2 TRGJ1*02 [TRG]
CGTCTTCTGTACTATGACGTCTCCAACTCAAAGGATGTGTTGGAATCAGGACTCAGTCCAGGAAAGTATTATACTCATACACCCAGGAGGTGGAGCTGGATATTGATACTACGAAATCTAATTGAAAATGATTCTGGGGTCTATTACTGTGCCACCTGGGGGGCCAGATTATAAGAAACTCTTTGGCAGTGGAACAACAC
>1/TGAGGCGGAGAGATCGGGGG/5_IGHD2-15*01_1/AACGGTAAGT/5_IGHJ5*02__IGH
>1/TGAGGCGGAGAGATCGGGGG/5 IGHD2-15*01 1/AACGGTAAGT/5 IGHJ5*02 [IGH]
GGGGGAGGCTTGGTACAGCCTGGGGGGTCCCTGAGACTCTCCTGTGCAGCCTCTGGATTCACCTTCAGTAGCTACGACATGCACTGGGTCCGCCAAGCTACAGGAAAAGGTCTGGAGTGGGTCTCAGCTATTGGTACTGCTGGTGACACATACTATCCAGGCTCCGTGAAGGGCCGATTCACCATCTCCAGAGAAAATGCCAAGAACTCCTTGTATCTTCAAATGAACAGCCTGAGAGCCGGGGACACGGCTGTGTATTACTGTGCAAGAGTGAGGCGGAGAGATCGGGGGATTGTAGTGGTGGTAGCTGCTACTCAACGGTAAGTTGGTTCGACCCCTGGGGCCAGGGAACCCTGGTCACCGTCTCCTCAGGT
# or IGHV3-74*01 (-9)
>IGHV3-74*02_7/CCGCGGT/6_IGHD3-9*01_4/CTTCGAACA/7_IGHJ4*02__IGH
>IGHV3-74*02 7/CCGCGGT/6 IGHD3-9*01 4/CTTCGAACA/7 IGHJ4*02 [IGH]
GGAGTCGGGGGGAGGCTTAGTTCAGCCTGGGGGGTCCCTGAGACTCTCCTGTGCAGCCTCTGGATTCACCTTCAGTAGCTACTGGATGCACTGGGTCCGCCAAGCTCCAGGGAAGGGGCTGGTGTGGGTCTCACGTATTAATAGTGATGGGAGTAGCACAAGCTACGCGGACTCCGTGAAGGGCCGATTCACCATCTCCAGAGACAACGCCAAGAACACGCTGTATCTGCAAATGAACAGTCTGAGAGCCGAGGACACGGCTGTGTATTACTGCCGCGGTCGATATTTTGACTGGTTATTACTTCGAACATGACTACTGGGGCCAGGGAACCCTGGTCACCGTCTCCTCAGGT
>TRDV2*02_14/TCCCGGCCT/0_TRDD3*01_3/CCACGGC/4_TRAJ29*01__TRA+D
>TRDV2*02 14/TCCCGGCCT/0 TRDD3*01 3/CCACGGC/4 TRAJ29*01 [TRA+D]
ATACCGAGAAAAGGACATCTATGGCCCTGGTTTCAAAGACAATTTCCAAGGTGACATTGATATTGCAAAGAACCTGGCTGTACTTAAGATACTTGCACCATCAGAGAGAGATGAAGGGTCTTACTATCCCGGCCTACTGGGGGATCCACGGCTTCAGGAAACACACCTCTTGTCTTTGGAAAGGGCACAAGACTTTCTGTGATTGCAAGTAAGTGTTTCTAGCCATCCTTGATTTTGATCAGCAATGGCTTCTTCCCTTGAATTATTTTTCAGTGTACCTAGAATGCTTTTGCC
......@@ -9,5 +9,5 @@ ATACCGAGAAAAGGACATCTATGGCCCTGGTTTCAAAGACAATTTCCAAGGTGACATTGATATTGCAAAGAACCTGGCTG
# TRAJ29*01 ggaaTTCA----GGAA-ACACACCTCTTGTCTTT...
# 12345678
>TRDD2*01_13//8_TRAJ29*01__TRA+D
>TRDD2*01 13//8 TRAJ29*01 [TRA+D]
AGCGGGTGGTGATGGCAAAGTGCCAAGGAAAGGGAAAAAGGAAGAAGAGGGTTTTTATACTGATGTGTTTCATGGAAGGGACACCTCTTGTCTTTGGAAAGGGCACAAGACTTTCTGTGATTGCAAGTAAGTGTTTCTAGCCATCCTTGATTTTGATCAGCAATGGCTTCTTCCCTTGAATTATTTTTCAGTGTACCTAGAATGCTTTTGCC
\ No newline at end of file
# IGHD7-27 is very short and can be found only with a small seed or
# with upstream sequences
>IGHD7-27*01_10/CATTA/0_IGHJ3*02__IGH+
TTTTTTTTTTTTTTTCAAGCAGAAGACGGCATACGAGATCTCTCTAAGTTACGGTAGCAGAGACTTGGTCTCACAGGCCCCCTACCAGCCGCAGGGTTTTGGCTGAGCTGAGAACCACTGTGC
CATTA
TGATGCTTTTGATATCTGGGGCCAAGGGACAATGGTCACCGTCTCCTCAGGTAAG
>IGHD7-27*01 10/CATTA/0 IGHJ3*02 [IGH+]
TTTTTTTTTTTTTTTCAAGCAGAAGACGGCATACGAGATCTCTCTAAGTTACGGTAGCAGAGACTTGGTCTCACAGGCCCCCTACCAGCCGCAGGGTTTTGGCTGAGCTGAGAACCACTGTGCCATTATGATGCTTTTGATATCTGGGGCCAAGGGACAATGGTCACCGTCTCCTCAGGTAAG
>IGKV3D-20*01_3/AGGGG/11_KDE__IGK+
>IGKV3D-20*01 3/AGGGG/11 KDE [IGK+]
CCCAGGCTCCTCATCTATGATGCATCCAGCAGGGCCACTGGCATCCCAGACAGGTTCAGTGGCAGTGGGTCTGGGACAGACTTCACTCTCACCATCAGCAGACTGGAGCCTGAAGATTTTGCAGTGTATTACTGTCAGCAGTATGGTAGCTCACC
AGGGG
GGCAGCCCAGGGCGACTCCTCATGAGTCTGCAGCTGCATTTTTGCCATATCCACTATTTGGAGTCTGACCTCCCTAGGAAGCCTCCCTGCTCCCTAGGACAACCTGCTCTGACCTCTGAGG
\ No newline at end of file
>TRDD2*01_0/CGAG/3_TRDD3*01__TRD+
>TRDD2*01 0/CGAG/3 TRDD3*01 [TRD+]
AGCGGGTGGTGATGGCAAAGTGCCAAGGAAAGGGAAAAAGGAAGAAGAGGGTTTTTATACTGATGTGTTTCATTGTGCCTTCCCACCGAGGGGGGATACGCACAGTGCTACAAAACCTACAGAGACCTGTACAAAAACTGCAGGGGCAAAAGTGCCATTTCCCTGGGATATCCTCACCCTGGGTCCCA
\ No newline at end of file
......@@ -3,5 +3,5 @@
# but we are not seeking for two Ds at the time. So we will restrict
# to the 5' and 3' genes.
>TRDD2*01_0/TGGGGGATCCCCATTGGAGGG/14_TRAJ29*01__TRA+D
>TRDD2*01 0/TGGGGGATCCCCATTGGAGGG/14 TRAJ29*01 [TRA+D]
AGCGGGTGGTGATGGCAAAGTGCCAAGGAAAGGGAAAAAGGAAGAAGAGGGTTTTTATACTGATGTGTTTCATTGTGCCTTCTTACTGGGGGATCCCCATTGGAGGGACACCTCTTGTCTTTGGAAAGGGCACAAGACTTTCTGTGATTGCAAGTAAGTGTTTCTAGCCATCCTTGATTTTGATCAGCAATGGCTTCTTCCCTTGAATTATTTTTCAGTGTACCTAGAATGCTTTTGCC
\ No newline at end of file
......@@ -3,5 +3,5 @@
# Either TRA+D (correct)
# or TRD (TRV1-TRDD2-TRDJ2)
>TRDV1*01_5//3_TRDD2*01_1//7_TRAJ29*01__TRA+D
>TRDV1*01 5//3 TRDD2*01 1//7 TRAJ29*01 [TRA+D]
AGCGGGTGGTGATGGCAAATGCCAAGGAAGGGAAAAGGAAGAAGAGGGTTTTTATACTGATGTGTTTCATTGTGGGCACAGTGCTACAAAACCTACAGAGACCTGTACAAAAACTGCAGGGGCAAAAGTGCCATTTCCCTGGGATATCCTCACCCTGGTCCCAATGCAAAAAGTGGTCGCTATTCTGTCAACTTCAAGAAAGCAGCGAAATCCGTCGCCTTAACCATTTCAGCCTTACAGCTAGAAGATTCAGCAAAGTACTTTTGTGCTCTTGGGTCCTAAGGAAACACACCTCTTGTCTTTGGAAAGGGCACAAGACTTTCTGTGATTGCAAGTAAGTGTTTCTAGCCATCCTTGATTTTGATCAGCAATGGCTTCTTCCCTTGAATTATTTTTCAGTGTACCTAGAATGCTTTTGCC
>IGKV1-5*03 -9/4/-1 IGKJ1*01 [IGK]
>IGKV1-5*03 9/4/1 IGKJ1*01 [IGK]
CTCCTGCTACTCTGGCTCCCAGGTGCCAAATGTGACATCCAGATGACCCAGTCTCCTTCCACCCTGTCTGCGTCTGTAGGAGACAGAGTCACCATCACCTGCCGGGCCAGTCAGAGTATTAATAACAACTTGGCCTGGTATCAGGAGAAGCCAGGGAAAGCCCCTAAGGTCCTGATCTATAAGGCGTCTAGTTTAGAAAGTGGGGTCCCATCAAGGTTCAGCGGCAGTGGATCTGGGACAGAATTCACTCTCACCATCAGCAGCCTGCAGCCTGATGATTTTGCAACCTATTACTGCCAACAATATAATAGACTTTGGACGTTCGGCCAAGGGACCAAGGTGGAAGTCAAACGAACTGTGGCTGCACCATCT
\ No newline at end of file
>IGLV2-14*01 -12/4/-0 IGLJ3*02 [IGL]
>IGLV2-14*01 12/4/0 IGLJ3*02 [IGL]
GGTCCTGGGCCCAGTCTGCCCTGACTCAGCCTGCCTCCGTGTCTGGGTCTCCTGGACAGTCGATCACCATCTCCTGCACTGGAACCAGCAGTGACGTTGGTGGTTATAACTATGTCTCCTGGTACCAACAGCACCCAGGCAAAGCCCCCAAACTCATGATTTATGAGGTCAGTAATCGGCCCTCAGGGGTTTCTAATCGCTTCTCTGGCTCCAAGTCTGGCAACACGGCCTCCCTGACCATCTCTGGGCTCCAGGCGAGGACGAGGCTGATTATTACTGCAGCTCATATACAAGCTTTCTTGGGTGTTCGGCGGAGGGACCAAGCTG
\ No newline at end of file
......@@ -2,7 +2,7 @@
### Copied from data/segment_simul.fa and algo/tests/segment_simul.should_get
>IGHV5-10-1*01_2/CTTC/3_IGHD1-14*01_1/GTTA/5_IGHJ5*01__IGH
>IGHV5-10-1*01 2/CTTC/3 IGHD1-14*01 1/GTTA/5 IGHJ5*01 [IGH]
aagtccatcagcactgcctacctgcagtggagcagcctgaaggcctcggacaccgccatgtattactgtgcga
CTTC
ataaccggaacca
......
>TRBD2*01_1/CCACT/2_TRBJ2-3*01__TRB+
>TRBD2*01 1/CCACT/2 TRBJ2-3*01 [TRB+]
GGTGTAACATTGTGGGGACTAGCGGGGGGCCACTCACAGATACGCAGTATTTTGGCCCAGGCACCCGGCTGACAGTGCTCGGTAAGCGGGGGCTCCCGCTGAAGCCCGGGAACTGGGGAGGGGGCGCCCCGGGACGCCGGGGGCGT
>TRDD2*01_0//0_TRDJ1*01 TRD+
>TRDD2*01 0//0 TRDJ1*01 [TRD+]
TATACTGATGTGTTTCATTGTG
ccttcctac
acaccgataaactcatctttggaaaaggaacccgtgtgactgtggaaccaa
>TRDD2*01_0//0_TRDD3*01 TRD+
>TRDD2*01 0//0 TRDD3*01 [TRD+]
TATACTGATGTGTTTCATTGTG
ccttcctac
actgggggatacg
CACAGTGCTACAAAACCTACAGAGACCTGTAC
>TRDV3*01_0//0_TRDD3*01 TRD+
>TRDV3*01 0//0 TRDD3*01 [TRD+]
atctctccagtaaggactgaagacagtgccacttactactgtgcctttag
actgggggatacg
CACAGTGCTACAAAACCTACAGAGACCTGTAC
......
Markdown is supported
0% or
You are about to add 0 people to the discussion. Proceed with caution.
Finish editing this message first!
Please register or to comment