Commit 53009ea3 authored by Mikaël Salson's avatar Mikaël Salson

Merge branch 'feature-a/3295-option-names-and-help' into 'dev'

Feature a/3295 option names and help

Closes #3785 and #3295

See merge request !434
parents ad2af586 ae5890aa
Pipeline #67627 passed with stages
in 5 minutes and 34 seconds
!LAUNCH: $VIDJIL_DIR/$EXEC -KA -k 16 -z 0 -g ../../../germline/homo-sapiens.g:IGH bug20150604.fa
!LAUNCH: $VIDJIL_DIR/$EXEC -K --all -k 16 -z 0 -g ../../../germline/homo-sapiens.g:IGH bug20150604.fa
$ Bug on some architectures, not segmented
1: junction detected in 1 reads
......
!LAUNCH: $VIDJIL_DIR/$EXEC -s '#####-#####' -c clones -r 1 -g ../../../germline/homo-sapiens.g:IGH -t 0 -e 1e-2 bug20160121.fa
!LAUNCH: $VIDJIL_DIR/$EXEC -s '#####-#####' -c clones -r 1 -g ../../../germline/homo-sapiens.g:IGH -e 1e-2 bug20160121.fa
$ Sequences should not be segmented since they only contain J.
1:UNSEG only J/3' -> 2
!LAUNCH: $VIDJIL_DIR/$EXEC $VIDJIL_DEFAULT_OPTIONS -A -c clones -g $VIDJIL_DIR/germline/homo-sapiens.g:IGH $VIDJIL_DATA/test_representatives.fa
!LAUNCH: $VIDJIL_DIR/$EXEC $VIDJIL_DEFAULT_OPTIONS --all -c clones -g $VIDJIL_DIR/germline/homo-sapiens.g:IGH $VIDJIL_DATA/test_representatives.fa
$ Three clones should be found
1:3 clones
......
!LAUNCH: $VIDJIL_DIR/$EXEC -a -g $VIDJIL_DIR/germline/homo-sapiens-cd.g -A $VIDJIL_DATA/cd-19-trimmed.fa
!LAUNCH: $VIDJIL_DIR/$EXEC --all --out-reads -g $VIDJIL_DIR/germline/homo-sapiens-cd.g $VIDJIL_DATA/cd-19-trimmed.fa
$ Load CD-sorting.fa
1:homo-sapiens/CD-sorting.fa .* 28 sequences
......
!LAUNCH: $VIDJIL_DIR/$EXEC -K -g $VIDJIL_DIR/germline/homo-sapiens-cd.g -A $VIDJIL_DATA/cd-4-19.fa ; grep 'seed' out/cd-4-19.affects
!LAUNCH: $VIDJIL_DIR/$EXEC -K -g $VIDJIL_DIR/germline/homo-sapiens-cd.g --all $VIDJIL_DATA/cd-4-19.fa ; grep 'seed' out/cd-4-19.affects
$ Load CD-sorting.fa
1:homo-sapiens/CD-sorting.fa .* 28 sequences
......
!LAUNCH: $VIDJIL_DIR/$EXEC $VIDJIL_DEFAULT_OPTIONS -g $VIDJIL_DIR/germline -A -2 $VIDJIL_DATA/2549.fa
!LAUNCH: $VIDJIL_DIR/$EXEC $VIDJIL_DEFAULT_OPTIONS -g $VIDJIL_DIR/germline --all -2 $VIDJIL_DATA/2549.fa
$ The KmerSegmenter segments the chimera on xxx germline (-2)
1:unexpected .* -> .* 1
......
!LAUNCH: $VIDJIL_DIR/$EXEC $VIDJIL_DEFAULT_OPTIONS -A -t 0 -g $VIDJIL_DIR/germline -2 $VIDJIL_DATA/chimera-fake.fa
!LAUNCH: $VIDJIL_DIR/$EXEC $VIDJIL_DEFAULT_OPTIONS --all -g $VIDJIL_DIR/germline -2 $VIDJIL_DATA/chimera-fake.fa
$ The KmerSegmenter segments the three chimera reads on PSEUDO_MAX12 germline (-2)
1:unexpected .* -> .* 3
......
!LAUNCH: $VIDJIL_DIR/$EXEC $VIDJIL_DEFAULT_OPTIONS -A -g $VIDJIL_DIR/germline -2 $VIDJIL_DATA/chimera-fake-D.fa
!LAUNCH: $VIDJIL_DIR/$EXEC $VIDJIL_DEFAULT_OPTIONS --all -g $VIDJIL_DIR/germline -2 $VIDJIL_DATA/chimera-fake-D.fa
$ The KmerSegmenter segments the chimera reads on PSEUDO_MAX12 germline (-2)
f1:unexpected .* -> .* 2
......
!LAUNCH: $VIDJIL_DIR/$EXEC $VIDJIL_DEFAULT_OPTIONS -A -g $VIDJIL_DATA/chimera-fake-VJ-trim.g $VIDJIL_DATA/chimera-fake-VJ.fa
!LAUNCH: $VIDJIL_DIR/$EXEC $VIDJIL_DEFAULT_OPTIONS --all -g $VIDJIL_DATA/chimera-fake-VJ-trim.g $VIDJIL_DATA/chimera-fake-VJ.fa
# Testing a custom (fake) .g with special parameters for the algorithm
$ The KmerSegmenter segments no read in Y because of the parameter
......
!LAUNCH: $VIDJIL_DIR/$EXEC $VIDJIL_DEFAULT_OPTIONS -A -g $VIDJIL_DATA/chimera-fake-VJ.g $VIDJIL_DATA/chimera-fake-VJ.fa
!LAUNCH: $VIDJIL_DIR/$EXEC $VIDJIL_DEFAULT_OPTIONS --all -g $VIDJIL_DATA/chimera-fake-VJ.g $VIDJIL_DATA/chimera-fake-VJ.fa
# Testing a custom (fake) germlines.data
$ Report the species
......
!LAUNCH: $VIDJIL_DIR/$EXEC $VIDJIL_DEFAULT_OPTIONS -A -g $VIDJIL_DIR/germline -2 $VIDJIL_DATA/chimera-fake-VJ.fa
!LAUNCH: $VIDJIL_DIR/$EXEC $VIDJIL_DEFAULT_OPTIONS --all -g $VIDJIL_DIR/germline -2 $VIDJIL_DATA/chimera-fake-VJ.fa
$ The KmerSegmenter segments the five chimera reads on PSEUDO_MAX12 germline (-2)
1:unexpected .* -> .* 5
......
!LAUNCH: $VIDJIL_DIR/$EXEC $VIDJIL_DEFAULT_OPTIONS -e 100 -A -t 0 -g $VIDJIL_DIR/germline -4 $VIDJIL_DATA/chimera-fake-half.fa
!LAUNCH: $VIDJIL_DIR/$EXEC $VIDJIL_DEFAULT_OPTIONS -e 100 --all -g $VIDJIL_DIR/germline -4 $VIDJIL_DATA/chimera-fake-half.fa
# TODO: a more precise modeling should give a e-value computation that could make this work even with -e 1
$ The KmerSegmenter segments the six chimera reads on PSEUDO_MAX1U germline (-4)
......
!LAUNCH: $VIDJIL_DIR/$EXEC $VIDJIL_DEFAULT_OPTIONS -A -uU -g $VIDJIL_DIR/germline $VIDJIL_DATA/chimera-trg.fa
!LAUNCH: $VIDJIL_DIR/$EXEC $VIDJIL_DEFAULT_OPTIONS --all -uU -g $VIDJIL_DIR/germline $VIDJIL_DATA/chimera-trg.fa
$ Do not segment on IG/TR by chance
12:(IG|TR).* -> .* 0
......
!LAUNCH: $VIDJIL_DIR/$EXEC $VIDJIL_DEFAULT_OPTIONS -g $VIDJIL_DIR/germline/homo-sapiens.g -c clones -A -3 $VIDJIL_DATA/segment_lec.fa
!LAUNCH: $VIDJIL_DIR/$EXEC $VIDJIL_DEFAULT_OPTIONS -g $VIDJIL_DIR/germline/homo-sapiens.g -c clones --all -3 $VIDJIL_DATA/segment_lec.fa
$ Extract up to 50bp windows (TRG)
1:windows up to 50bp
......
!LAUNCH: $VIDJIL_DIR/$EXEC $VIDJIL_DEFAULT_OPTIONS -k 14 -w 50 -c clones -V $VIDJIL_DIR/germline/homo-sapiens/IGHV.fa -J $VIDJIL_DIR/germline/homo-sapiens/IGHJ.fa -y 3 -z 0 -r 1 -n 5 $VIDJIL_DATA/clones_simul.fa ; cat out/clones_simul.vidjil
!LAUNCH: $VIDJIL_DIR/$EXEC $VIDJIL_DEFAULT_OPTIONS -k 14 -w 50 -c clones -V $VIDJIL_DIR/germline/homo-sapiens/IGHV.fa -J $VIDJIL_DIR/germline/homo-sapiens/IGHJ.fa -y 3 -z 0 -r 1 --cluster-epsilon 5 $VIDJIL_DATA/clones_simul.fa ; cat out/clones_simul.vidjil
$ Window extractions
1:windows up to 50bp
......
!LAUNCH: $VIDJIL_DIR/$EXEC $VIDJIL_DEFAULT_OPTIONS -KA -g $VIDJIL_DIR/germline/homo-sapiens.g:IGH+ -r 4 -b co $VIDJIL_DATA/D7-27--J1.fa ; cat out/co.vidjil
!LAUNCH: $VIDJIL_DIR/$EXEC $VIDJIL_DEFAULT_OPTIONS -K --all -g $VIDJIL_DIR/germline/homo-sapiens.g:IGH+ -r 4 -b co $VIDJIL_DATA/D7-27--J1.fa ; cat out/co.vidjil
# Test D7-27 0/92/0 J1 non-recombination
......
!LAUNCH: $VIDJIL_DIR/$EXEC $VIDJIL_DEFAULT_OPTIONS -x 2000 -t 0 -g $VIDJIL_DIR/germline/homo-sapiens.g:IGH -FaW GAGAGGTTACTATGATAGTAGTGGTTATTACGGGGTAGGGCAGTACTACT $VIDJIL_DATA/Stanford_S22.fasta ; cat out/seq/clone.fa-1
!LAUNCH: $VIDJIL_DIR/$EXEC $VIDJIL_DEFAULT_OPTIONS -x 2000 -g $VIDJIL_DIR/germline/homo-sapiens.g:IGH --grep-reads GAGAGGTTACTATGATAGTAGTGGTTATTACGGGGTAGGGCAGTACTACT $VIDJIL_DATA/Stanford_S22.fasta ; cat out/seq/clone.fa-1
# See also label-grep-reads.should-get
$ Keep only one windows, the one given by -W, with only 2 reads in the first 2000 reads (it is actually the second clone in Stanford_S22.fasta)
1: keep 1 windows in 2 reads
......
!LAUNCH: $VIDJIL_DIR/$EXEC $VIDJIL_DEFAULT_OPTIONS -KA -z 0 -s 10s -V $VIDJIL_DIR/germline/homo-sapiens/IGHV.fa -J $VIDJIL_DIR/germline/homo-sapiens/IGHJ.fa -D $VIDJIL_DIR/germline/homo-sapiens/IGHD.fa $VIDJIL_DATA/common-V-D.fa ; cat out/common-V-D.affects
!LAUNCH: $VIDJIL_DIR/$EXEC $VIDJIL_DEFAULT_OPTIONS -K --all -z 0 -s 10s -V $VIDJIL_DIR/germline/homo-sapiens/IGHV.fa -J $VIDJIL_DIR/germline/homo-sapiens/IGHJ.fa -D $VIDJIL_DIR/germline/homo-sapiens/IGHD.fa $VIDJIL_DATA/common-V-D.fa ; cat out/common-V-D.affects
$ Segments the sequence
1: SEG .* -> .* 1
......
!LAUNCH: $VIDJIL_DIR/$EXEC $VIDJIL_DEFAULT_OPTIONS -c segment reads 2>&1
!LAUNCH: $VIDJIL_DIR/$EXEC $VIDJIL_DEFAULT_OPTIONS -c segment -aAtl reads 2>&1
!EXIT_CODE: 1
$ Deprecated option
1:is deprecated
$ Deprecated options
5:is deprecated
$ Advice on usage
1:-c designations
1:--trim
1:--all
1:--label
1:--out-reads
......@@ -5,5 +5,5 @@ $ Unknown option
1:error.* --hello
$ Refer to online help and documentation
1:run with -h
1:run with --help
1:see doc/vidjil-algo.md
!LAUNCH: $VIDJIL_DIR/$EXEC $VIDJIL_DEFAULT_OPTIONS -Z 10 -A -x 30 -v -g $VIDJIL_DIR/germline/homo-sapiens.g:IGH $VIDJIL_DATA/Stanford_S22.fasta
!LAUNCH: $VIDJIL_DIR/$EXEC $VIDJIL_DEFAULT_OPTIONS --analysis-filter 10 --all -x 30 -v -g $VIDJIL_DIR/germline/homo-sapiens.g:IGH $VIDJIL_DATA/Stanford_S22.fasta
$ Clone 13 is correctly analyzed
1:FLN1FA001EP9M2.* IGHV2-26.* 2/GAT.*GCC/8 IGHJ2
$ Statistics on -Z
1:Statistics on clone analysis
rb1: IGH 3[0-2][0-9]{2}/ 1[0-2][0-9]{3} 28..%
rb1: IGH 3[0-2][0-9]{2}/ 1[0-2][0-9]{3} 28..%
\ No newline at end of file
!LAUNCH: $VIDJIL_DIR/$EXEC $VIDJIL_DEFAULT_OPTIONS -x 2000 -g $VIDJIL_DIR/germline/homo-sapiens.g:IGH --out-reads --label-filter --label GAGAGGTTACTATGATAGTAGTGGTTATTACGGGGTAGGGCAGTACTACT $VIDJIL_DATA/Stanford_S22.fasta ; cat out/seq/clone.fa-1
# See also combo-grep-reads.should-get
$ Keep only one windows, the one given by -W, with only 2 reads in the first 2000 reads (it is actually the second clone in Stanford_S22.fasta)
1: keep 1 windows in 2 reads
$ Tbere are the three IGHV/D/J genes in out/seq/clone.fa-1
3:>IGH
$ There are 2 reads in out/seq/clone.fa-1
2:>lcl
!LAUNCH: $VIDJIL_DIR/$EXEC $VIDJIL_DEFAULT_OPTIONS -c designations -g $VIDJIL_DIR/germline/homo-sapiens.g:IGH -A $VIDJIL_DATA/overlap-d-j.fa | grep -v out | tail -4 | tr -d '\n' | wc -c
!LAUNCH: $VIDJIL_DIR/$EXEC $VIDJIL_DEFAULT_OPTIONS -c designations -g $VIDJIL_DIR/germline/homo-sapiens.g:IGH --all $VIDJIL_DATA/overlap-d-j.fa | grep -v out | tail -4 | tr -d '\n' | wc -c
$ Exported sequence has all the bases
1:116
......
!LAUNCH: $VIDJIL_DIR/$EXEC $VIDJIL_DEFAULT_OPTIONS -c clones -A -g $VIDJIL_DIR/germline/homo-sapiens.g:TRG -A $VIDJIL_DATA/segment_lec.fq > /dev/null ; cat out/segment_lec.vidjil
!LAUNCH: $VIDJIL_DIR/$EXEC $VIDJIL_DEFAULT_OPTIONS -c clones --all -g $VIDJIL_DIR/germline/homo-sapiens.g:TRG $VIDJIL_DATA/segment_lec.fq > /dev/null ; cat out/segment_lec.vidjil
$ Window
1:"id": "GGGGTCTATTACTGTGCCACCTGGGCCTTATTATAAGAAACTCTTTGGCA"
......
!LAUNCH: $VIDJIL_DIR/$EXEC $VIDJIL_DEFAULT_OPTIONS -A -g $VIDJIL_DIR/germline/homo-sapiens.g:TRG ../should-vdj-tests/ext-nucleotides-N.should-vdj.fa
!LAUNCH: $VIDJIL_DIR/$EXEC $VIDJIL_DEFAULT_OPTIONS --all -g $VIDJIL_DIR/germline/homo-sapiens.g:TRG ../should-vdj-tests/ext-nucleotides-N.should-vdj.fa
$ Segments on TRG
1: TRG .* -> .* 1
......
!LAUNCH: $VIDJIL_DIR/$EXEC $VIDJIL_DEFAULT_OPTIONS -e 10 -g $VIDJIL_DIR/germline/homo-sapiens.g:IGH -W ACCGGTATTACT -W CAGCTGCTCCCC -W TGGGCCACTC -W ATCAACGCTGGCAATGGTAACACTAAATATTCACAGAAGTTCCAGGGCAGAGTCACCATTACCAGGGACACATACGCGAGCACAGCCTACATGGAGCTGAGCAGCCTGAGATCTGAAGACACGGCTCTGTATTACTGTGCGAGAGTGCGCAGCAGCTGGTCTGATGCTTTTGATTATCTGG $VIDJIL_DATA/clones_simul.fa
!LAUNCH: $VIDJIL_DIR/$EXEC $VIDJIL_DEFAULT_OPTIONS -e 10 -g $VIDJIL_DIR/germline/homo-sapiens.g:IGH --label ACCGGTATTACT --label CAGCTGCTCCCC --label TGGGCCACTC --label ATCAACGCTGGCAATGGTAACACTAAATATTCACAGAAGTTCCAGGGCAGAGTCACCATTACCAGGGACACATACGCGAGCACAGCCTACATGGAGCTGAGCAGCCTGAGATCTGAAGACACGGCTCTGTATTACTGTGCGAGAGTGCGCAGCAGCTGGTCTGATGCTTTTGATTATCTGG $VIDJIL_DATA/clones_simul.fa
$ ACCGGTATTACT is found (in window and representative and in the command line)
3:ACCGGTATTACT
......
!LAUNCH: $VIDJIL_DIR/$EXEC $VIDJIL_DEFAULT_OPTIONS -A -w all -g $VIDJIL_DIR/germline/homo-sapiens.g $VIDJIL_DATA/s-somatic.fa ; cat out/s-somatic.vidjil | python $VIDJIL_DIR/tools/format_json.py -1
!LAUNCH: $VIDJIL_DIR/$EXEC $VIDJIL_DEFAULT_OPTIONS --all -w all -g $VIDJIL_DIR/germline/homo-sapiens.g $VIDJIL_DATA/s-somatic.fa ; cat out/s-somatic.vidjil | python $VIDJIL_DIR/tools/format_json.py -1
$ No clustering due to -w all
1: considering all analyzed reads as windows
......
!LAUNCH: $VIDJIL_DIR/$EXEC $VIDJIL_DEFAULT_OPTIONS -z 2 -r 5 -a -g $VIDJIL_DIR/germline/homo-sapiens.g:IGH $VIDJIL_DATA/Stanford_S22.fasta ; cat out/seq/clone.fa-2
# Testing detailed clone output (-a)
!LAUNCH: $VIDJIL_DIR/$EXEC $VIDJIL_DEFAULT_OPTIONS -z 2 -r 5 --out-reads -g $VIDJIL_DIR/germline/homo-sapiens.g:IGH $VIDJIL_DATA/Stanford_S22.fasta ; cat out/seq/clone.fa-2
# Testing detailed clone output (--out-reads)
$ Detailed clone output (out/seq/clone.fa-2), germline
# IGHV1-8*01 could also be detected
......
!LAUNCH: ($LAUNCHER $VIDJIL_DIR/$EXEC $EXTRA $VIDJIL_DEFAULT_OPTIONS -c germlines -g $VIDJIL_DIR/germline/homo-sapiens.g:TRA,TRB,TRD,TRG,IGH,IGK,IGL -t 100 -s '######-######' $VIDJIL_DATA/Stanford_S22.fasta)
!LAUNCH: ($LAUNCHER $VIDJIL_DIR/$EXEC $EXTRA $VIDJIL_DEFAULT_OPTIONS -c germlines -g $VIDJIL_DIR/germline/homo-sapiens.g:TRA,TRB,TRD,TRG,IGH,IGK,IGL --trim 100 -s '######-######' $VIDJIL_DATA/Stanford_S22.fasta)
$ number of reads and kmers
1:13153 reads, 3020179 kmers
......
!LAUNCH: $VIDJIL_DIR/$EXEC $VIDJIL_DEFAULT_OPTIONS -x 100 -z 0 -g $VIDJIL_DIR/germline/homo-sapiens.g:IGH -r 5 -W ACTGTGCGAGAGTTGGAATTAGTAGTGGCTGGCCTGATTCCTGGGGCCAG $VIDJIL_DATA/Stanford_S22.fasta ; cat out/Stanford_S22.vidjil
!LAUNCH: $VIDJIL_DIR/$EXEC $VIDJIL_DEFAULT_OPTIONS -x 100 -z 0 -g $VIDJIL_DIR/germline/homo-sapiens.g:IGH -r 5 --label ACTGTGCGAGAGTTGGAATTAGTAGTGGCTGGCCTGATTCCTGGGGCCAG $VIDJIL_DATA/Stanford_S22.fasta ; cat out/Stanford_S22.vidjil
$ Some clone has only one read, bypassing the -r 5 option, and the good label
1: clone-00..*0001-.* -W
1: clone-00..*0001-.* --label
$ The label appears in the json output
1: "label": "-W"
1: "label": "--label"
!LAUNCH: $VIDJIL_DIR/$EXEC $VIDJIL_DEFAULT_OPTIONS -z 0 -g $VIDJIL_DIR/germline/homo-sapiens.g:IGH -x 100 -r 5 -l $VIDJIL_DATA/Stanford_S22.label $VIDJIL_DATA/Stanford_S22.fasta ; cat out/Stanford_S22.vidjil
!LAUNCH: $VIDJIL_DIR/$EXEC $VIDJIL_DEFAULT_OPTIONS -z 0 -g $VIDJIL_DIR/germline/homo-sapiens.g:IGH -x 100 -r 5 --label-file $VIDJIL_DATA/Stanford_S22.label $VIDJIL_DATA/Stanford_S22.fasta ; cat out/Stanford_S22.vidjil
$ Some clone has only one read, bypassing the -r 5 option, and the good label
1: clone-00..*0001-.* my-clone
......
!LAUNCH: $VIDJIL_DIR/$EXEC $VIDJIL_DEFAULT_OPTIONS -y 0 -t 1 -g $VIDJIL_DIR/germline/homo-sapiens.g:IGH -x 100 $VIDJIL_DATA/Stanford_S22.fasta
!LAUNCH: $VIDJIL_DIR/$EXEC $VIDJIL_DEFAULT_OPTIONS -y 0 --trim 1 -g $VIDJIL_DIR/germline/homo-sapiens.g:IGH -x 100 $VIDJIL_DATA/Stanford_S22.fasta
$ No read segmented as we have no germline because of the -t
$ No read segmented as we have no germline because of the --trim
1: UNSEG too few V/J -> 100
!LAUNCH: $VIDJIL_DIR/$EXEC $VIDJIL_DEFAULT_OPTIONS -A -g $VIDJIL_DIR/germline/homo-sapiens.g:TRB $VIDJIL_DATA/trb-only-VJ.fa ; cat out/trb-only-VJ.vidjil
!LAUNCH: $VIDJIL_DIR/$EXEC $VIDJIL_DEFAULT_OPTIONS --all -g $VIDJIL_DIR/germline/homo-sapiens.g:TRB $VIDJIL_DATA/trb-only-VJ.fa ; cat out/trb-only-VJ.vidjil
$ Segments the read on TRB (the information is given twice, stdout + .vidjil)
2: TRB .* -> .* 1
......
!LAUNCH: $VIDJIL_DIR/$EXEC $VIDJIL_DEFAULT_OPTIONS -A -g $VIDJIL_DIR/germline/homo-sapiens.g:TRD $VIDJIL_DATA/trd-dd2-dd3.fa
!LAUNCH: $VIDJIL_DIR/$EXEC $VIDJIL_DEFAULT_OPTIONS --all -g $VIDJIL_DIR/germline/homo-sapiens.g:TRD $VIDJIL_DATA/trd-dd2-dd3.fa
$ Segment only 2 reads, because we do not look for incomplete recombinations
1:junction detected in 2 reads
......
!LAUNCH: $VIDJIL_DIR/$EXEC $VIDJIL_DEFAULT_OPTIONS -w 10 -e 10 -A -g $VIDJIL_DIR/germline $VIDJIL_DATA/trd-dd2-dd3.fa
!LAUNCH: $VIDJIL_DIR/$EXEC $VIDJIL_DEFAULT_OPTIONS -w 10 -e 10 --all -g $VIDJIL_DIR/germline $VIDJIL_DATA/trd-dd2-dd3.fa
$ Segment 6 reads, thanks to -i
1:junction detected in 6 reads
......
!LAUNCH: $VIDJIL_DIR/$EXEC $VIDJIL_DEFAULT_OPTIONS -K -A -e 10 -k 8 -w 20 -V $VIDJIL_DIR/germline/homo-sapiens/TRDV.fa -V $VIDJIL_DIR/germline/homo-sapiens/TRDD2+up.fa -J $VIDJIL_DIR/germline/homo-sapiens/TRDD3+down.fa -J $VIDJIL_DIR/germline/homo-sapiens/TRDJ.fa $VIDJIL_DATA/trd-dd2-dd3.fa ; cat out/trd-dd2-dd3.affects
!LAUNCH: $VIDJIL_DIR/$EXEC $VIDJIL_DEFAULT_OPTIONS -K --all -e 10 -k 8 -w 20 -V $VIDJIL_DIR/germline/homo-sapiens/TRDV.fa -V $VIDJIL_DIR/germline/homo-sapiens/TRDD2+up.fa -J $VIDJIL_DIR/germline/homo-sapiens/TRDD3+down.fa -J $VIDJIL_DIR/germline/homo-sapiens/TRDJ.fa $VIDJIL_DATA/trd-dd2-dd3.fa ; cat out/trd-dd2-dd3.affects
$ Segment all 8 reads, thanks to TRDD2 and TRDD3
1: junction detected in 8 reads .100..
......
!LAUNCH: $VIDJIL_DIR/$EXEC $VIDJIL_DEFAULT_OPTIONS -f '1, 2, 3, 4, 5' $VIDJIL_DATA/Stanford_S22.fasta
!LAUNCH: $VIDJIL_DIR/$EXEC $VIDJIL_DEFAULT_OPTIONS --analysis-cost '1, 2, 3, 4, 5' $VIDJIL_DATA/Stanford_S22.fasta
!EXIT_CODE: 1
$Check that correct custom cost is used
......
......@@ -5,7 +5,7 @@ $ License
1:vidjil-algo is free software
$ Check default costs
1:segmenter .* "4, -6, -10, -1, -10"
1:analysis.* "4, -6, -10, -1, -10"
1:clustering .* "1, -4, -4, 0, 0"
$ Show seeds
......@@ -17,4 +17,4 @@ $ Display advanced options
: custom Cost
$ Correct number of options
B51:^ -
B52:^ -
......@@ -7,12 +7,12 @@ $ License
$ Check default filtering options
1: =5 .* minimal number of reads supporting a clone
1: =0 .* minimal percentage of reads supporting a clone
1: =100 .* maximal number of clones computed with a consensus sequence
1: =100 .* maximal number of clones to be analyzed
1: =100 .*maximal number of clones computed with a consensus sequence
1: max-designations .*=100
$ Do not display advanced options
0: , experimental options
0: custom Cost
$ Correct number of regular options
B25:^ -
B24:^ -
!LAUNCH: $VIDJIL_DIR/$EXEC $VIDJIL_DEFAULT_OPTIONS -A -g $VIDJIL_DIR/germline/homo-sapiens.g:IGH $VIDJIL_DATA/toy_V.fa ; cat out/toy_V.vidjil | python $VIDJIL_DIR/tools/format_json.py -1
!LAUNCH: $VIDJIL_DIR/$EXEC $VIDJIL_DEFAULT_OPTIONS --all -g $VIDJIL_DIR/germline/homo-sapiens.g:IGH $VIDJIL_DATA/toy_V.fa ; cat out/toy_V.vidjil | python $VIDJIL_DIR/tools/format_json.py -1
$ Warning, -A
$ Warning, --all
1:WARNING
$ Warning in json output
......
This diff is collapsed.
This diff is collapsed.
......@@ -234,7 +234,7 @@ def run_vidjil(id_file, id_config, id_data, grep_reads,
if grep_reads:
# TODO: security, assert grep_reads XXXX
vidjil_cmd += ' -FaW "%s" ' % grep_reads
vidjil_cmd += ' --grep-reads "%s" ' % grep_reads
os.makedirs(out_folder)
out_log = out_folder+'/'+output_filename+'.vidjil.log'
......
Markdown is supported
0% or
You are about to add 0 people to the discussion. Proceed with caution.
Finish editing this message first!
Please register or to comment