Commit 50238f19 authored by Mikaël Salson's avatar Mikaël Salson

algo/: Separate the sequence name with a tab in all case

This should ease parsing the output.
parent 1f3d1d48
......@@ -361,7 +361,7 @@ string Segmenter::getInfoLine() const
{
string s = "" ;
s += (segmented ? "" : "! ") + info ;
s += (segmented ? "" : "\t ! ") + info ;
s += " " + info_extra ;
s += " " + segmented_germline->code ;
s += " " + string(segmented_mesg[because]) ;
......
>lcl|FLN1FA002RWEZA.1|
ggctggagtgggtttcatacattagtagtaatagtggtgccatatactacgcagactctgtgaagggccgattcaccatc
tccagaaacaatgccaaggactcactgtatctgcaaatgaacagcctgagagccgaggacacggctgtgtattactgtgc
gagagcgatcccccggtattactatgatactagtggcccaaacgactactggggccagggaaccctggtcaccgtctcct
cag
>unsegmented
CGAATGCCTACATAGGGCTGGACGGCGTGCGTATTCCGTTACTACGACGATTCAAGGTAGTACAGCAAGACCACTGACCACTCCCGTGAGATATTTACCGAACGCCATTACGTATTGACACCGCAGTAATGACCTGGGTGGGGCATAGTCAAATTTCTGATGCTGGATAGTTTAATCCGCAGAGATTTTGTACTTGGCGATTGCTACACGATGTGTAGTAAATGATGAATATTCATAATCACCTTTCTGTGCCGATGGCATAGGGGGACCAATACCTCTGTTCGATGAACTAAGCTGGGA
>unexpected-IGHV-TRGJ
ATCTGCAAATGAACAGCCTGAGAGCCGAGGACACGGCTGTGTATTACTGTGCGAGAG
CGATCCCCCGGTATTACTATGATACTAGTGGCCCAAAC
atagtagtgattggatcaagacgtttgcaaaagggactaggctcatagtaacttcgcctg
\ No newline at end of file
!LAUNCH: $VIDJIL_DIR/$EXEC $VIDJIL_DEFAULT_OPTIONS -2 -c designations -g $VIDJIL_DIR/germline $VIDJIL_DATA/segment-or-not.fa
$ Check that output has one tab for each sequence
3:^>.*\t
\ No newline at end of file
Markdown is supported
0% or
You are about to add 0 people to the discussion. Proceed with caution.
Finish editing this message first!
Please register or to comment