Commit 4bea3388 authored by Mikaël Salson's avatar Mikaël Salson

browser/tests: Change a sequence to have an Ig locus

parent ef355121
......@@ -29,7 +29,7 @@ class TestMultilocus < BrowserTest
end
def test_00_germline
assert ($b.div(:id => 'info').span(:class => 'systemBoxNameMenu').text.include? 'TRA'), 'missing system TRA'
assert ($b.div(:id => 'info').span(:class => 'systemBoxNameMenu', :index => 1).text.include? 'TRA'), 'missing system TRA'
end
def test_00_legend_scatterplot
......
......@@ -510,18 +510,15 @@
"id": "TGTGCTAGCAGTTTATGGGACAGGGGAGACACCCAGTACT"
},
{
"germline": "TRB",
"name": "TRBV29*01 -5/5/-0 TRBD2*01 -3/2/-6 TRBJ2-5*01",
"sequence": "YYGGGYYACGYAYAGCGGYGYTTYYCCTYTYTGYTYTGCYAAAYAACYYYYTGTGYCTYTGTGCYGYGTYCCCGGYCTGGGGGTGYYCCYGYCTTTGGGCYGGYCYGGCYCYGTGTYYGYYTYYAATGTYCYYCCYAG",
"germline": "IGH",
"name": "IGHV3-9*01 7/CCCGGA/17 IGHJ6*02",
"sequence": "GGAGTCGGGGGAGGCTTGGTACAGCCTGGCAGGTCCCTGAGACTCTCCTGTGCAGCCTCTGGATTCACCTTTGATGATTATGCCATGCACTGGGTCCGGCAAGCTCCAGGGAAGGGCCTGGAGTGGGTCTCAGGTATTAGTTGGAATAGTGGTAGCATAGGCTATGCGGACTCTGTGAAGGGCCGATTCACCATCTCCAGAGACAACGCCAAGAACTCCCTGTATCTGCAAATGAACAGTCTGAGAGCTGAGGACACGGCCTTGTATTACTGTGCACCCGGAGGTATGGACGTCTGGGGCCAAGGGACCCTGGTCACC",
"top": 14,
"seg": {
"5end": 92,
"4end": 108,
"5start": 0,
"3": "TRBJ2-5*01",
"5": "TRBV29*01",
"4": "TRBD2*01",
"4start": 98,
"3": "IGHJ6*02",
"5": "IGHV3-9*01",
"3start": 111
},
"reads": [
......@@ -533,7 +530,7 @@
"2": 331
}
],
"id": "TGTGCYGYGTYCCCGGYCTGGGGGTGYYCCYGT"
"id": "CGCCAAGAACTCCCTGTATCTGCAAATG"
},
{
"germline": "TRB",
......
Markdown is supported
0% or
You are about to add 0 people to the discussion. Proceed with caution.
Finish editing this message first!
Please register or to comment