Commit 486adbdd authored by Mikael Salson's avatar Mikael Salson

7849-deleted-J.should-vdj.fa: Missing locus

parent f9403618
......@@ -3,7 +3,7 @@
# seq TGCCACCTGGGACTCTTCTGTTGTCACAGGTAAGTATC
# ||||||||||||||||||||
# TRGJ2*01 GAATTATTATAAGAAACTCTTTGGCAGTGGAACAACACTTGTTGTCACAGGTAAGTATC
>TRGV3*01 3/TCTTC/39 TRGJ2*01
>TRGV3*01 3/TCTTC/39 TRGJ2*01 [TRG]
CTACACCAGGAGGGGAAGGCCCCACAGCGTCTTCTGTACTATGACGTCTACACCGCAAGGGATGTGTTGGAATCAGGACTCAGTCCAGGAAAGTATTATACTCATACACCAAGGAGGTGGAGCTGGATATTGAGACTGCAAAATCTAATTGAAAATGATTCTGGGGTCTATTACTGTGCCACCTGGGAC
TCTTC
TGTTGTCACAGGTAAGTATCGGAAGAAT
\ No newline at end of file
Markdown is supported
0% or
You are about to add 0 people to the discussion. Proceed with caution.
Finish editing this message first!
Please register or to comment