Commit 4848f047 authored by Mikaël Salson's avatar Mikaël Salson

stanford-fuse.should-get: Replace a failed test with something working

What was tested was not output anymore by fuse.py.
This replaces the test with something somewhat similar that is now output.
That also ensure the distribution is slightly tested.
parent 17feb24d
!REQUIRES: python $VIDJIL_DIR/tools/check_python_version.py
!LAUNCH: $VIDJIL_DIR/$EXEC $VIDJIL_DEFAULT_OPTIONS -z 0 -w 60 -g $VIDJIL_DIR/germline/homo-sapiens.g:IGH $VIDJIL_DATA/Stanford_S22.fasta ; python $VIDJIL_DIR/tools/fuse.py out/Stanford_S22.vidjil out/Stanford_S22.vidjil -o out/fused.data ; cat out/fused.data | python $VIDJIL_DIR/tools/format_json.py -1
!LAUNCH: $VIDJIL_DIR/$EXEC $VIDJIL_DEFAULT_OPTIONS -r 1 -z 0 -w 60 -g $VIDJIL_DIR/germline/homo-sapiens.g:IGH $VIDJIL_DATA/Stanford_S22.fasta ; python $VIDJIL_DIR/tools/fuse.py out/Stanford_S22.vidjil out/Stanford_S22.vidjil -o out/fused.data ; cat out/fused.data | python $VIDJIL_DIR/tools/format_json.py -1
$ Points list
1:"original_names": \[".*data//Stanford_S22.fasta", ".*data//Stanford_S22.fasta"\]
......@@ -7,6 +7,5 @@ $ Points list
$ Most abundant window, twice, fused
1:"id": "CCACCTATTACTGTACCCGGGAGGAACAATATAGCAGCTGGTACTTTGACTTCTGGGGCC".*"reads": \[8, 8\].*"top": 2
# Fails since 49046ca6b97, no more 'others'
$ Windows that are not in the top 50
f1:"window": "others-1", .* "size": [ 12962, 12962 ]
$ Windows that are not in the bottom of the distribution
1: "distribution": \{[^}]+ "0.00001": \[9061, 9061\]
Markdown is supported
0% or
You are about to add 0 people to the discussion. Proceed with caution.
Finish editing this message first!
Please register or to comment