Commit 438a906d authored by Mathieu Giraud's avatar Mathieu Giraud Committed by Mikaël Salson

should-vdj-tests/BRI_TRB.should-vdj.fa: a JDJ recombination ?

See #3145 and #3146.
parent 18ce10f2
......@@ -8,7 +8,8 @@ tccccctgatcctggagtcgcccagccccaaccagacccaaag
ctacgagcagtacttcgggccgggcaccaggctcacggttacaggtaag
#target 0447GG
>TRBD2*02 1/AATG/0 TRBJ2-3*01 [TRB+] BUG
#See #3145, this sequence may be a TRBJ2-2 ... TRBD2 ... TRBJ2-3 !
>TRBD2*02 1/AATG/0 TRBJ2-3*01 [TRB+] TODO
CAGGGCTGAGCGAACACCGGGGAGCTGTTTTTTGGAGAAGGCTCTAGGCTGACCGTACTGGGTAAGGAGGCG
GTTGGGGCTCCGGAGAGCTCCGAGAGGGCGGGATGGGCAGAGGTAAGCAGCTGCCCCACTCTGAGAGGGGCT
GTGCTGAGAGGTTTTTCCAAGCCCCACACAGTCAGACTAACCTCTGCCACCTGCGCTTCCTGCCGCTGCCCA
......
Markdown is supported
0% or
You are about to add 0 people to the discussion. Proceed with caution.
Finish editing this message first!
Please register or to comment