Commit 436ca4b8 authored by Mathieu Giraud's avatar Mathieu Giraud

tests: 'seq-ambiguous-VJVJ' in segmentation.fasta is now correctly reported as UNSEG_AMBIGUOUS.

This sequence was previously called 'seq-delta-min-old'.
What a coincidence, this sequence is almost the same than the 'ambiguous' sequence added three commits ago.
parent 783d0b19
......@@ -202,14 +202,9 @@ void testSegmentationCause() {
TAP_TEST(! ks.isSegmented(), TEST_KMER_IS_SEGMENTED, "fewJ2: " << ks.getInfoLineWithAffects());
TAP_TEST(ks.getSegmentationStatus() == UNSEG_TOO_FEW_J, TEST_KMER_SEGMENTATION_CAUSE, ks.getInfoLineWithAffects());
nb_checked++;
} else if (data.read(i).label == "seq-delta-min-old") {
// This test was a test for delta_min but with the CountKmerAffectAnalyser
// the read is segmented, now. So we keep it, but change the test
TAP_TEST(ks.isSegmented(), TEST_KMER_IS_SEGMENTED, "delta-min: " << ks.getInfoLineWithAffects());
TAP_TEST(ks.getSegmentationStatus() == SEG_PLUS, TEST_KMER_SEGMENTATION_CAUSE, ks.getInfoLineWithAffects());
TAP_TEST(ks.getJunction(30) == "GCCACCTGGGACAGGGAATTATTATAAGAA"
|| ks.getJunction(30) == "TGCCACCTGGGACAGGGAATTATTATAAGA",
TEST_KMER_JUNCTION, "junction: " << ks.getJunction(30));
} else if (data.read(i).label == "seq-ambiguous-VJVJ") {
TAP_TEST(! ks.isSegmented(), TEST_KMER_IS_SEGMENTED, "ambiguous-VJVJ: " << ks.getInfoLineWithAffects());
TAP_TEST(ks.getSegmentationStatus() == UNSEG_AMBIGUOUS, TEST_KMER_SEGMENTATION_CAUSE, ks.getInfoLineWithAffects());
nb_checked++;
} else if (data.read(i).label == "seq-delta-min") {
TAP_TEST(ks.isSegmented(), TEST_KMER_IS_SEGMENTED, "delta-min: " << ks.getInfoLineWithAffects());
......
......@@ -20,7 +20,8 @@ tgtgccacctgggacaggAAAAAAAAAAAAAAAAA
TTTTTTTTTTTTTTTTTcctgtcccaggtggcaca
>seq-fewJ2
tgcaaaatctaattaaaaatgattctgggttctattactgtgccacctgggacaggAAAAAAAAAAAAAAAAAA
>seq-delta-min-old
>seq-ambiguous-VJVJ
tgtgccacctgggacaggGAATTATTATAAGAAACTtgtgccacctgggacaggGAATTATTATAAGAAACT
>seq-delta-min
cttgggcagttggaacaacACTTGTTGTCACAG
......
Markdown is supported
0% or
You are about to add 0 people to the discussion. Proceed with caution.
Finish editing this message first!
Please register or to comment