Commit 4243edae authored by Mathieu Giraud's avatar Mathieu Giraud

tests: update tests

parent b6c52a49
Pipeline #47203 passed with stages
in 56 minutes and 8 seconds
......@@ -36,8 +36,8 @@ $ Two clones are productive, no clone is labeled as non-productive
$ v_call for 2 clones (-z 2)
2:IGHV
$ First clone window appears third times (clone_id, sequence_id, sequence)
w3:TATTACTGTACCCGGGAGGAACAATATAGCAGCTGGTACTTTGACTTCTG
$ First clone window appears two times (sequence_id, sequence)
w2:TATTACTGTACCCGGGAGGAACAATATAGCAGCTGGTACTTTGACTTCTG
$ Junction of the first clone appears once, but CDR3 twice (it is also included in the junction)
1:CTREEQYSSWYFDFW
......
Markdown is supported
0% or
You are about to add 0 people to the discussion. Proceed with caution.
Finish editing this message first!
Please register or to comment