Commit 3dab4df3 authored by Thonier Florian's avatar Thonier Florian Committed by Mikael Salson

test_functional; test_multilocus; change top positon of the tested unexpected clone

link to #3512
parent f6a09715
Pipeline #52448 failed with stages
in 3 minutes and 23 seconds
......@@ -199,7 +199,7 @@ class TestMultilocus < BrowserTest
$b.clone_in_scatterplot('77').click
$b.clone_in_scatterplot('25').click(:control)
$b.clone_in_scatterplot('88').click(:control)
$b.clone_in_scatterplot('99').click(:control)
$b.clone_in_scatterplot('50').click(:control)
$b.menu_item_export_fasta.click
assert ( $b.window(:title => "").exists? ) , ">> fail opening fasta export "
......@@ -207,7 +207,7 @@ class TestMultilocus < BrowserTest
assert ($b.text.include? ">TRBV29*01 -1/0/-0 TRBD1*01 -2/0/-5 TRBJ2-5*01"), "header name"
assert ($b.text.include? "YYGGGYYACGYAYAGCGGYGYTTYYCCTYTYTGYTYTGCYAAAYAACYYYYTGTGYCTYTGTGCYGYGTTYCCCGGYYYAAACYCYCYYCCTYGG\nCYAGGYCYGG"), "sequence"
assert ($b.text.include? ">ERG-4F 0/TCT/0 ERG-Seq-R"), "header name locus ERG"
assert (not $b.text.include? ">ERG-4F\n"), "header name of segment should not exist (segment is not present in germline"
assert (not $b.text.include? ">ERG-4F\n"), "header name of segment should not exist (segment is not present in germline)"
end
end
......
......@@ -47,7 +47,7 @@
1632, 0
],
"ERG": [
288, 0
362, 0
]
}
},
......@@ -124,21 +124,6 @@
],
"id": "YTGTGCYGYGYCCCYYGGYYAAAYCCTTGY"
},
{
"germline": "TRB",
"sequence": 0,
"top": 50,
"seg_stat": [
{
"1": 132,
"2": 230
}
],
"reads": [
362
],
"id": "CTGTGCYGYGYYCTGGGGGGTYCYTYAYGYC"
},
{
"germline": "TRB",
"sequence": 0,
......@@ -1761,13 +1746,13 @@
{
"germline": "ERG",
"sequence": "GTCTAACTCAGAAGCATCTCACGGTAAGGAAAAATTTTCCTTTCTGATGAAAATCAAATGTAAAACACTGTAACAAAAAAAGAGGACATTTCCAATTATTTAAAAAATGGATACCTCCCACTTTTTCCAAAAGTAAAAAAAAAAAAAGAATTTGGAATGGCTTACCAAACAGATTACAATAAATCATAGTCTAAGATAAACATCTGAAGCACTTGGGGCTTTCTGGTGCGTGAGGCTAGAGTGAAGAAAGGGAGAGGGTGGCTGTGGACCACCGAAGCTGA",
"top": 100,
"top": 50,
"name": "ERG-4F 0/TCT/0 ERG-Seq-R",
"seg_stat": {
"3": 9832
},
"reads": [
288
362
],
"id": "AAATCATAGTCTAAGATAAACATCTGAAGCACTTGGGGCTTTCTGGTGCG"
......
Markdown is supported
0% or
You are about to add 0 people to the discussion. Proceed with caution.
Finish editing this message first!
Please register or to comment