Commit 3b381f59 authored by Mikaël Salson's avatar Mikaël Salson

Merge branch 'feature-a/3890-unexpected-name' into 'dev'

Better handle 'name' field for 'unexpected' sequences

Closes #3890

See merge request !457
parents 5a4af716 cbfff9d5
Pipeline #95260 passed with stages
in 6 minutes and 41 seconds
......@@ -1404,10 +1404,6 @@ void FineSegmenter::toOutput(CloneOutput *clone){
});
}
}
else // not segmented
{
clone->set("name", label);
}
}
json toJsonSegVal(string s) {
......
>unexpected_name
TGTTTGCAGGTGTCCAGTGTCAGGTGAAACTGGTGGAGTCTGGGGGAGGCGTGGTCCGCCCTGGGAGGTCCCTGAGACTCTCCTGTGCCGACCTCCAGGACAGAGGACGCTGGGCCCAGAGAGACGAGGCAGAAAGAACCCCTCGTTCTTGAAGAGACGGTGACCATCGTCCCTTGGCCGCAGATATCGAAAGCATCATTTCCCCTGTCACAGTAGTCGATTCTACTAAAAGAGTCGCGGCCCCTAGTTTGACTACTGGGGCCAGAGAACCCTGGTCACCGTCTCCTCAGGTAAG
\ No newline at end of file
......@@ -5,3 +5,10 @@ $ The KmerSegmenter segments the chimera on xxx germline (-2)
$ The FineSegmenter gives the locus information (-2)
1:Unexpected .*\+IGKV/-IGKV
!NO_LAUNCHER:
!LAUNCH: cat out/2549.vidjil
$ The designation is the "name" field in the .json
1: "name": "IGKV1/OR-2.01 21//15 IGKV1/OR-2.01"
!LAUNCH: $VIDJIL_DIR/$EXEC $VIDJIL_DEFAULT_OPTIONS -g $VIDJIL_DIR/germline/homo-sapiens.g -r 1 $VIDJIL_DATA/unexpected_name.fa ; cat out/unexpected_name.vidjil
$ Name of unsegmented sequence should be the window itself
1: "id": "TCGTTCTTGAAGAGACGGTGACCATCGTCCCTTGGCCGCAGATATCGAAA"
......@@ -1637,6 +1637,7 @@ int main (int argc, char **argv)
CloneOutput *clone = new CloneOutput();
output.addClone(id, clone);
clone->set("id", id);
clone->set("name", seq.label);
clone->set("sequence", seq.sequence);
clone->set("reads", { 1 });
clone->set("top", 0);
......
Markdown is supported
0% or
You are about to add 0 people to the discussion. Proceed with caution.
Finish editing this message first!
Please register or to comment