Commit 39f89153 authored by Mathieu Giraud's avatar Mathieu Giraud

tests: lazy_mza, another test

parent b69092f4
!LAUNCH: export REQUEST_METHOD=POST ; export CONTENT_TYPE=test ; $LAUNCHER $VIDJIL_DIR/browser/cgi/align.cgi < $VIDJIL_DIR/data/msa3.fa
$ no spurious info
0: .* bp in .* sequences
$ response header
1:Content-type: text/html
$ seq1 (reference sequence for lazy msa)
1:------CCCTAGAGGGAAATATACAGGG---
$ seq2
1:CATGGACCCTAG-GGGAAA---ACAGGGCCC
>seq1
CCCTAGAGGGAAATATACAGGG
>seq2
CATGGACCCTAGGGGAAAACAGGGCCC
Markdown is supported
0% or
You are about to add 0 people to the discussion. Proceed with caution.
Finish editing this message first!
Please register or to comment