Commit 39f18ddc authored by Mikaël Salson's avatar Mikaël Salson

tests: Test that a sequence with a large N is correctly segmented

parent 07b831c6
!LAUNCH: ../../vidjil -G ../../germline/IGH -r 1 ../../data/large_N.fa
$ Find a huge insertion in the segmentation
1:>clone-001.*/[ACGT]{100}
>609_JHR8Z:03718:02531__IGH
GAGCTCTGTGACCGCCGCGGACACGCCTTTTCTAGCTGGAACATTTGTGAGGCTGGAATTTAAGCTCTGGCAGACAGGCGGCAGAAGAAGGACTGGAAGAAAACCCAAGTGCAAAGTCCAGCCCAAAGGAGAGGAAGCGGAAATGCCTGGCCTGGTCAAACTGTGCTCTGACTAGAAGATTCTGGGCTGGATGGTCACCGTCTCCTCAGGTAAGGTCATAGCTGTTTCCTG
Markdown is supported
0% or
You are about to add 0 people to the discussion. Proceed with caution.
Finish editing this message first!
Please register or to comment