Commit 35d132fe authored by florian.thonier's avatar florian.thonier

algo/test/trb-bd2-bj2-3 : add should get & fasta test

parent 70d8d5b5
!LAUNCH: ../../vidjil -e 10 -A -i -g ../../germline ../../data/trb-bd2-bj2-3.fa
$ Segment all 5 reads, thanks to -i
1:junction detected in 1 reads .100..
>TRBD2*01 -1/5/-2 TRBJ2-3*01
GGTGTAACATTGTGGGGACTAGCGGGGGGCCACTCACAGATACGCAGTATTTTGGCCCAGGCACCCGGCTGACAGTGCTCGGTAAGCGGGGGCTCCCGCTGAAGCCCGGGAACTGGGGAGGGGGCGCCCCGGGACGCCGGGGGCGT
Markdown is supported
0% or
You are about to add 0 people to the discussion. Proceed with caution.
Finish editing this message first!
Please register or to comment