Commit 35cd4fe8 authored by Mathieu Giraud's avatar Mathieu Giraud

format-analysis.org: highlights/features in 'seg'

parent 931b1433
......@@ -20,7 +20,8 @@ present in the =.vidjil= file.
** =.vidjil= file -- one sample
This is a minimal =.vidjil= file, describing clones in one sample.
This is an almost minimal =.vidjil= file, describing clones in one sample.
The =seg= element is optional.
The segmentation is here =TRGV5*01 5/CC/0 TRGJ1*02=.
Note that other elements could be added by some program (such as =tag= or =clusters=).
......@@ -54,7 +55,8 @@ Note that other elements could be added by some program (such as =tag= or =clust
"seg":
{
"5": "TRGV5*01", "5start": 0, "5end": 86,
"3": "TRGJ1*02", "3start": 89, "3end": 118
"3": "TRGJ1*02", "3start": 89, "3end": 118,
"cdr3": { "start": 77, "stop": 104, "seq": "gccacctgggccttattataagaaactc" }
}
}
......@@ -265,6 +267,10 @@ In the .analysis file, this section is intended to describe some specific clones
"3": "IGHJ3*02",
"3start": 0,
"3end": 0,
// any feature to be highligthen in the sequenc
// the optional "seq" element gives a sequence that corresponds to this feature
"somefeature": { "start": 0, "stop": 0, "seq": "" }
}
......
Markdown is supported
0% or
You are about to add 0 people to the discussion. Proceed with caution.
Finish editing this message first!
Please register or to comment