Commit 34633fc8 authored by Mikaël Salson's avatar Mikaël Salson

BRI_IGH: Bug D assignation

The D gene is trimmed but there are 7nt left. This should pass our
threshold. Should it?
parent c8f863cf
......@@ -99,7 +99,7 @@ CTACTACTACTACATGGACGTCTGGGGCAAAGGGACCACGGTCACCGTCTCCTCAGGT
#target 0889CE
>IGHV1-3*01 3/GCT/2 IGHD2-15*01 22/CCCCCG/16 IGHJ6*02 [IGH]
>IGHV1-3*01 3/GCT/2 IGHD2-15*01 22/CCCCCG/16 IGHJ6*02 [IGH] BUG
TAAAACGACGGCCAGTCTGGGGCTGAGGTGAAGAAGCCTGGGGCCTCAGTGAAGGTTTCCTGCAAG
GCTTCTGGATACACCTTCACTAGCTATGCTATGCATTGGGTGCGCCAGGCCCCCGGACAAAGGCTTGAGTGG
ATGGGATGGATCAACGCTGGCAATGGTAACACAAAATATTCACAGAAGTTCCAGGGCAGAGTCACCATTACC
......
Markdown is supported
0% or
You are about to add 0 people to the discussion. Proceed with caution.
Finish editing this message first!
Please register or to comment