Commit 300773e7 authored by Mathieu Giraud's avatar Mathieu Giraud

tests: this curated-vdj test does actually work

See #1879.
parent cbcff399
# sequence: GTGTGAACTCCTGGAGTGGTGGTAGCGGAACTGGTTC
# sequence: GTGTGAACTCCTGGAGTGGTGGTAGCGGGAACTGGTTC
# |||||||
# IGHV3-64D*06 GTGTGAAAGA |||||||||
# IGHJ5*02 ACAACTGGTTC
# IGHV3-64D*06 GTGTGAAAGA |||||||||
# IGHJ5*02 ACAACTGGTTC
# || ||||||||||||
# IGHD2-15*01 AGGATATTGTAGTGGTGGTAGCTGCTACTCC
>IGHV3-64D*06 (3/CTCC/7, 3/CTCCTGG/10) IGHD2-15*01 9/GG/2 IGHJ5*02 [IGH]
>IGHV3-64D*06 (3/CTCC/7, 3/CTCCTGG/10) IGHD2-15*01 9/GGG/2 IGHJ5*02 [IGH]
CCAGGGAAGGGACTGGAATATGTTTCAGCTATTAGTAGTAATGGGGGTAGCACATACTACGCAGACTCCGTGAAGGGCAGATTCACCATCTCCAGAGACAATTCCAAGAACACGCTGTATCTTCAAATGAGCAGTCTGAGAGCTGAGGACACGGCTGTGTATTACTGTGTGA
ACTCCTGGAGTGGTGGTAGCGG
GAACTGGTTCGACCCCTGGGGCCAGGGAACCCTGGTCAC
Markdown is supported
0% or
You are about to add 0 people to the discussion. Proceed with caution.
Finish editing this message first!
Please register or to comment