Commit 2ef0f282 authored by Mikaël Salson's avatar Mikaël Salson

0215-ren-unseg.should-locus.fa: Bug unrelated to this feature

See #3296 for the bug.

This is unrelated to this issue.
parent 438a906d
# PCR dimer (V4-K5), should not be segmented
#
>dimer__UNSEG
>dimer__UNSEG BUG
GAGCTCTGTGACCGCCGCGGACACGACTGGAGATTAAACGTAAGTGTAGAACCATGTCGTCAGTGTAGATCTCGGTGGTCGCCGTATCATTAAAAAAAAA
Markdown is supported
0% or
You are about to add 0 people to the discussion. Proceed with caution.
Finish editing this message first!
Please register or to comment