Commit 288382ea authored by Mikael Salson's avatar Mikael Salson

gosh-igh.should-vdj.fa: See #3370

parent c5b33506
Pipeline #32933 failed with stages
in 40 minutes and 18 seconds
......@@ -156,7 +156,7 @@ AGCTCTGCTGATTTGTGGGCACTTATGAACCCGAAAGGACATGGCCATGGGGTGGGTAGGGACATAGGGACAGATGCCAG
CGCCCCACTTGATATTCCTTTTAGCCAGCTATGCCATGAGCTGGGTCCGCCAGGCTCCAGGGAAGGGGCTGGAGTGGGTCTCAGCTATTAGTGGTAGTGGTGGTAGCACATACTACGCAGACTCCGTGAAGGGCCGGTTCACCATCTCCAGAGACAATTCCAAGAACACGCTGTATCTGCAAATGAACAGCCTGAGAGCCGAGGACACGGCCGTATATTACTGTGCGAAAGGGTGGGAGGTATTAAACTATGGTTCGGGGAGTTATTATAACGTTGATGCTTTTGATATCTGGGGCCAAGGGACAATGGTCACCGTCTCCTCAGGTAACTC
#1347 vh2
>IGHV2-26*02 0/5/5 IGHD5-24*01 4/13/7 IGHJ4*02 [IGH]
>IGHV2-26*02 0/5/5 IGHD5-24*01 4/13/7 IGHJ4*02 [IGH] BUG-LOCUS
TCAGAGACCTCACGCTGACCTGCACCGTCTCTGGGTTCTCACTCAGCAATGCTAGAATGGGTGTGAGCTGGATCCGTCAGCCCCCAGGGAAGGCCCTGGAGTGGCTTGCACACATTTTTTCGAATGACAAAAAATCCTACAGCACATCTCTGAAGAGCAGGCTCACCATCTCCAAGGACACCTCCAAAAGCCAGGTGGTCCTTACCATGACCAATATGGACCCTGTGGACACAGCCACATATTACTGTGCATGGATACCCGAGGATGGCTACAACGACAAGAGCCAATGACTACTGGGGCCAGGGAACGCTGGTCACCGTCTCCTCAGGTAAATCCATGCACAGTAATATGTGGCTGTGTCCACAGGGTCCATATTGGTCATGGTAAGGACCACCTGGCTTTTGGAGGTGTCCTTGGAGA
#1339 vh3
......
Markdown is supported
0% or
You are about to add 0 people to the discussion. Proceed with caution.
Finish editing this message first!
Please register or to comment