Commit 25b627b7 authored by Mathieu Giraud's avatar Mathieu Giraud

tests: testing unsegmentation causes

parent 2fe3a661
!LAUNCH: ../../vidjil -g ../../germline ../../data/no-vdj.fa
!LAUNCH: ../../vidjil -g ../../germline -u ../../data/no-vdj.fa ; cat out/no-vdj.unsegmented.vdj.fa
$ No sequence is segmented
1: junction detected in 0 reads
$ Only one sequence is segmented, but it is too small for a window (too short w)
1: junction detected in 1 reads
1: found 0 50-windows in 0 reads
$ The proper unsegmentation cause is given
1: UNSEG only V -> .* 0
1: UNSEG only J -> .* 0
1: UNSEG too short -> .* 1
1: UNSEG strand -> .* 1
1: UNSEG too few V/J -> .* 3
1: UNSEG only V -> .* 1
1: UNSEG only J -> .* 1
1: UNSEG ambiguous -> .* 1
1: UNSEG too short w -> .* 1
$ The proper unsegmentation cause is given in the .unsegmented.vdj.fa file
1: >too_short .* UNSEG too short
1: >strand .* UNSEG strand
3: >too_few_vj-..* UNSEG too few V/J
1: >only_V .* UNSEG only V
1: >only_J .* UNSEG only J
1: >ambiguous .* UNSEG ambiguous
1: >too_short_w .* UNSEG too short w
# Testing unsegmentation classification
# Sequences outside any V(D)J locus
>nothing-1
>too_few_vj-1
CTAGGCATGGCTCCTCTCCACAGGAAAACTCCACTCCAGTGCTCAGCTTGCACCCTGGCACAGGCCAGCAGTTGCTGGAAGTCAGACACCTGAGAAGAAC
>nothing-2
>too_few_vj-2
GCCTCAGGCCAGCCTTCCGCTCCTTGAAGCTGGTCTCCGCACAGTGCTGGTTCCGTCACCCCCACCCAGGGAAGCAGGTCTGAGCAGCTTGTCCTGGCTG
>nothing-3
CACAGCTAGAGATCCTTTATTAAAAGCACACTGTTGGTTTCTGCTCAGTTCTTTATTGATTGGTGTGCCGTTTTCTCTGGAAGCCTCTTAAGAACACAGT
\ No newline at end of file
>too_few_vj-3
CACAGCTAGAGATCCTTTATTAAAAGCACACTGTTGGTTTCTGCTCAGTTCTTTATTGATTGGTGTGCCGTTTTCTCTGGAAGCCTCTTAAGAACACAGT
# Fake sequences
>too_short
acgt
>strand IGKV1-12*01(revcomp)--IGKJ1*01
ggagggaaactgttagcctgttgacaatagtaagttgc
gtggacgttcggccaagggaccaaggtggaaatcaaac
>only_V TRDV1*01--nothing
ttacagctagaagattcagcaaagtacttttgtgctcttggggaact
CTAGGCATGGCTCCTCTCCACAGGAAAACTCCACCTAGGCATGGCTC
>only_J nothing--TRGJ1*01
CTAGGCATGGCTCCTCTCCACAGGAAAACTCCACCTAGGCATGGCTC
gaattattataagaaactctttggcagtggaacaacactggttgtcacag
>ambiguous TRGV1*01 TRGJ1*01 TRGV1*01 TRGJ1*01
ggaatcactccaggaaagtatgacactggaagcacaaggagcaattggaatttgaga
gaattattataagaaactctttggc
ctgcaaaatctaattaaaaatgattctgggttctattactgtgccacctgggacagg
agtggaacaacactggttgtcacag
>too_short_w TRGV1*01 TRGJ1*01
actgtgccacctgggacagg
gaattattataagaaactct
Markdown is supported
0% or
You are about to add 0 people to the discussion. Proceed with caution.
Finish editing this message first!
Please register or to comment