Commit 2523c922 authored by marc's avatar marc Committed by Mathieu Giraud

data/representative : replace representative fasta test files with fastQ

parent 125f5d41
>seq1
TAAAAAAAAAACCCCCCCCCCGGGGGGGGGGTTTTTTTTTTA
>seq2
AAAACCCCCCCCCCGGGGGGGGGGTTTTTTTTTTA
TAGGGCGCGATCGACTTC
>seq3
GCGCGATCGACTTCTCGAGCATGTAGGCTACACGGTA
TAAAAAAAAAACCCCCCCCCCGGGGGGGGGGTTTTTT
>seq4
TATAGGGCGCGATCGACTTC
@seq1
TAAAAAAAAAACCCCCCCCCCGGGGGGGGGGTTTTTTTTTTA
+
ABCDEFGHIJKLMNOPQRSTUVWXYZABCDEFGHIJKLMNOP
@seq2
AAAACCCCCCCCCCGGGGGGGGGGTTTTTTTTTTATAGGGCGCGATCGACTTC
+
ABCDEFGHIJKLMNOPQRSTUVWXYZABCDEFGHIJ<-------->UVWXYZA
@seq3
GCGCGATCGACTTCTCGAGCATGTAGGCTACACGGTATAAAAAAAAAACCCCCCCCCCGGGGGGGGGGTTTTTT
+
ABCDEFGHIJKLMNOPQRSTUVWXYZABCDEFGHIJKLMNOPQRSTUVWXYZABCDEFGHIJKLMNOPQRSTUV
@seq4
TATAGGGCGCGATCGACTTC
+
ABCDEFGHIJKLMNOPQRST
>lcl|FLN1FA002QB069.1|
@lcl|FLN1FA002QB069.1|
ggactggagtggattgggtatatctattacagtgggagcaccaactacaacccctccctcaagagtcgagtcaccatatcagtagacacgtccaagaaccagttctccctgaagctgagctctgtgaccgctgcggacacggccgtgtattactgtgcgagagggacatggtataacgacggctggcctcactttgactactggggcccgggaaccctggtcaccgtctcctcag
>lcl|FLN1FA001DWH5L.1|
+
ABCDEFGHIJKLMNOPQRSTUVWXYZABCDEFGHIJKLMNOPQRSTUVWXYZABCDEFGHIJKLMNOPQRSTUVWXYZABCDEFGHIJKLMNOPQRSTUVWXYZABCDEFGHIJKLMNOPQRSTUVWXYZABCDEFGHIJKLMNOPQRSTUVWXYZABCDEFGHIJKLMNOPQRSTUVWXYZABCDEFGHIJKLMN<_____________>DEFGHIJKLMNOPQRSTUVWXYZA
@lcl|FLN1FA001DWH5L.1|
cagtgggagcaccctttacaacccctccctcaagagtcgagtcaccatatcagaagacacgtccgagaaccagttctccctgaagctgagctctgtgaccgctgcggacacggccatatattactgtgcgagagggacatggtataacgacggctggcctcactttgactactggggcccgggaaccctggtcaccgtctcctcag
>lcl|FLN1FA001CU46B.1|
+
ABCDEFGHIJKLMNOPQRSTUVWXYZABCDEFGHIJKLMNOPQRSTUVWXYZABCDEFGHIJKLMNOPQRSTUVWXYZABCDEFGHIJKLMNOPQRSTUVWXYZABCDEFGHIJKLMNOPQRSTUVWXYZABCDEFGHIJKLMNOPQRSTUVWXYZABCDEFGHIJK<_____________>ABCDEFGHIJKLMNOPQRSTUVWX
@lcl|FLN1FA001CU46B.1|
gcctggagtggattgggtacatctattacagtgggagcacctactacaacccgtccctcaagagtcgagttaccatatcagtagacacgtctaagaaccagttctccctgaagctgagctctgtgactgccgcggacacggccgtgtattactgtgcgagagggacatggtataacgacggctggcctcactttgactactggggcccgggaaccctggtcaccgtctcctcag
>lcl|FLN1FA002Q5881.1|
+
ABCDEFGHIJKLMNOPQRSTUVWXYZABCDEFGHIJKLMNOPQRSTUVWXYZABCDEFGHIJKLMNOPQRSTUVWXYZABCDEFGHIJKLMNOPQRSTUVWXYZABCDEFGHIJKLMNOPQRSTUVWXYZABCDEFGHIJKLMNOPQRSTUVWXYZABCDEFGHIJKLMNOPQRSTUVWXYZABCDEFGHIJKLM<_____________>CDEFGHIJKLMNOPQRSTUVWXYZ
@lcl|FLN1FA002Q5881.1|
cagtgggagcaccctttacaacccctccctcaagagtcgagtcaccatatcagaagacacgtccgagaaccagttctccctgaagctgagctctgtgaccgctgcggacacggccatatattactgtgcgagagggacatggtataacgacggctggcctcactttgactactggggcccgggaaccctggtcaccgtctcctcag
>lcl|FLN1FA001CR02J.1|
+
ABCDEFGHIJKLMNOPQRSTUVWXYZABCDEFGHIJKLMNOPQRSTUVWXYZABCDEFGHIJKLMNOPQRSTUVWXYZABCDEFGHIJKLMNOPQRSTUVWXYZABCDEFGHIJKLMNOPQRSTUVWXYZABCDEFGHIJKLMNOPQRSTUVWXYZABCDEFGHIJK<_____________>ABCDEFGHIJKLMNOPQRSTUVWX
@lcl|FLN1FA001CR02J.1|
ggctggagtggattggggaaatcaatcatagtggaagcaccaactacaacccgtccctcaagagtcgagtcaccatatcagtagacacgtccaagaaccagttctccctgaagctgagctctgtgaccgccgcggacacggctgtgtattactgtgcgagagggacatggtataacgacggctggcctcactttgactactggggcccgggaaccctggtcaccgtctcctcag
+
ABCDEFGHIJKLMNOPQRSTUVWXYZABCDEFGHIJKLMNOPQRSTUVWXYZABCDEFGHIJKLMNOPQRSTUVWXYZABCDEFGHIJKLMNOPQRSTUVWXYZABCDEFGHIJKLMNOPQRSTUVWXYZABCDEFGHIJKLMNOPQRSTUVWXYZABCDEFGHIJKLMNOPQRSTUVWXYZABCDEFGHIJKLM<_____________>CDEFGHIJKLMNOPQRSTUVWXYZ
Markdown is supported
0% or
You are about to add 0 people to the discussion. Proceed with caution.
Finish editing this message first!
Please register or to comment