Commit 2493de3d authored by Mathieu Giraud's avatar Mathieu Giraud

tests: .vdj.fa headers, 1-based positions

parent f38085e3
......@@ -7,4 +7,4 @@ $ Find the good affects for the D segment, including a AMBIGUOUS k-mer, common w
1:_ _ _ \\?.f.f.f.f.f.f _ _ _ _
$ The windows found by the KmerSegmenter has a fairly good position
2: 0 162 179 219
2: 1 163 180 220
......@@ -13,7 +13,7 @@ $ First sequence Stanford
# D: 0 del (left), 10 del (right)
# N2: CCCAAAC
# J: 8 del
1:>lcl\\|FLN1FA002RWEZA.1\\|.*VDJ 0 164 175 195 203 242 IGHV3-48.0. 1/CGATCCCCCG/0 IGHD3-22.0. 10/CCCAAAC/8 IGHJ4.0.
1:>lcl\\|FLN1FA002RWEZA.1\\|.*VDJ 1 165 176 196 204 243 IGHV3-48.0. 1/CGATCCCCCG/0 IGHD3-22.0. 10/CCCAAAC/8 IGHJ4.0.
$ Second sequence Stanford
# 165 169 180
......@@ -28,7 +28,7 @@ $ Second sequence Stanford
# D: 7 del, 2 del
# N2: C
# J: 0 del
1:>lcl\\|FLN1FA001BLION.1\\|.*VDJ 0 165 169 180 182 232 IGHV1-3.01 1/TGG/7 IGHD6-13.0. 2/C/0 IGHJ3.0.
1:>lcl\\|FLN1FA001BLION.1\\|.*VDJ 1 166 170 181 183 233 IGHV1-3.01 1/TGG/7 IGHD6-13.0. 2/C/0 IGHJ3.0.
$ Third sequence Stanford
# 169 177 208 214
......@@ -44,4 +44,4 @@ $ Third sequence Stanford
# D : 0 del, 5 del
# N2 : TGGGT
# J : 10 del
1:>lcl\\|FLN1FA002SGU3N.1\\|.*VDJ 0 169 177 208 214 251 IGHV3-9.0. 0/AAATTGG/0 IGHD3-16.0. 5/TGGGT/10 IGHJ4.0.
1:>lcl\\|FLN1FA002SGU3N.1\\|.*VDJ 1 170 178 209 215 252 IGHV3-9.0. 0/AAATTGG/0 IGHD3-16.0. 5/TGGGT/10 IGHJ4.0.
......@@ -12,10 +12,10 @@ $ First sequence, easy segmentation (no error, few deletions at the windows, sma
# D3-16*01: gtattatgattacgtttgggggaGTTATGcttatacc
# J5*01 : 1 acaactggttcgactcctggggccaaggaaccctggtcaccgtctcctcag
# -2/CTTC/-3 -1/GTTA/5
1:^>seq1 \\+ VDJ 0 72 77 89 94 139 IGHV5-10-1.0[1-4] 2/CTTC/3 IGHD1-14.01 1/GTTA/5 IGHJ5.01
1:^>seq1 \\+ VDJ 1 73 78 90 95 140 IGHV5-10-1.0[1-4] 2/CTTC/3 IGHD1-14.01 1/GTTA/5 IGHJ5.01
# Note that a second D (D3-16*01) can be detected (6 common nucleotides, or even 7 with an overlap on the first D)
# This is tested in segment_simul.should-vdj
$ seq1_polyT is the same as seq1 but starts and ends with 10Ts, the recombination is in the middle. start position should not be 0 and end position should not be length-1
f1:^>seq1_polyT \\+ VDJ 10 82 87 99 104 149 IGHV5-10-1.0[1-4] 2/CTTC/3 IGHD1-14.01 1/GTTA/5 IGHJ5.01
f1:^>seq1_polyT \\+ VDJ 11 83 88 100 105 150 IGHV5-10-1.0[1-4] 2/CTTC/3 IGHD1-14.01 1/GTTA/5 IGHJ5.01
Markdown is supported
0% or
You are about to add 0 people to the discussion. Proceed with caution.
Finish editing this message first!
Please register or to comment