Commit 242de05f authored by Mathieu Giraud's avatar Mathieu Giraud

tdd: D7-27--J1 non-recombination should be warned

See #2232.
parent 72c6ab69
>NC_000014.9:c105865580-105865420 Homo sapiens chromosome 14, GRCh38.p12 Primary Assembly
TGAGCTGAGAACCACTGTGCTAACTGGGGACACAGTGATTGGCAGCTCTACAAAAACCATGCTCCCCCGG
GACCCCGGGCTGTGGGTTTCTGTAGCCCCTGGCTCAGGGCTGACTCACCGTGGCTGAATACTTCCAGCAC
TGGGGCCAGGGCACCCTGGTC
!LAUNCH: $VIDJIL_DIR/$EXEC $VIDJIL_DEFAULT_OPTIONS -KA -g $VIDJIL_DIR/germline/homo-sapiens.g:IGH+ -r 4 -b co $VIDJIL_DATA/D7-27--J1.fa ; cat out/co.vidjil
# Test D7-27 0/92/0 J1 non-recombination
$ Segmented on IGH+
1: "germline": "IGH\+"
$ Correct (non-)recombination
1: "name": "IGHD7-27.01 0/[ACGT]{92}/0 IGHJ1.01"
$ Warning
1: "code": "W61"
1: "msg": "Non-recombined D7-27/J1 sequence"
...@@ -42,8 +42,8 @@ Warnings which were implemented ([x]) have a fixed code that should not be chang ...@@ -42,8 +42,8 @@ Warnings which were implemented ([x]) have a fixed code that should not be chang
- [ ] Possible strand ambiguity - [ ] Possible strand ambiguity
*Strange recombination (FineSegmenter in vidjil-algo), V and J genes* *Strange recombination (FineSegmenter in vidjil-algo), V and J genes*
- [ ] W6x Co-linear recombination D7-J1 #2232
- [ ] Potential co-linear genome match (pos xxxxxx) #1664 #1629 - [ ] Potential co-linear genome match (pos xxxxxx) #1664 #1629
- [ ] W61 Non-recombined D7-27/J1 sequence #2232
- [ ] Potential di-mer #2820 - [ ] Potential di-mer #2820
- [ ] Very large deletion (xxx bp) #2909 - [ ] Very large deletion (xxx bp) #2909
- [ ] Unexpected recombination - [ ] Unexpected recombination
......
Markdown is supported
0% or
You are about to add 0 people to the discussion. Proceed with caution.
Finish editing this message first!
Please register or to comment