Commit 22d116a7 authored by Mathieu Giraud's avatar Mathieu Giraud

stanford-fuse.should_get: skip this test, no fuse.py is distributed in the release

We should perhaps distribute fuse.py within the .tar.gz.
parent e25be2c0
!LAUNCH: ../../vidjil -G ../../germline/IGH -d ../../data/Stanford_S22.fasta ; python ../../server/fuse.py out/vidjil.data out/vidjil.data -o out/fused.data ; cat out/fused.data | sh format-json.sh
$ Points list
1:"point": [ "", "" ]
f1:"point": [ "", "" ]
$ Most abundant window, twice, fused
1:"window": "CCACCTATTACTGTACCCGGGAGGAACAATATAGCAGCTGGTACTTTGACTTCTGGGGCC", "id": .*, "size": [ 8, 8 ]
f1:"window": "CCACCTATTACTGTACCCGGGAGGAACAATATAGCAGCTGGTACTTTGACTTCTGGGGCC", "id": .*, "size": [ 8, 8 ]
# Fails since 49046ca6b97, no more 'others'
$ Windows that are not in the top 50
......
Markdown is supported
0% or
You are about to add 0 people to the discussion. Proceed with caution.
Finish editing this message first!
Please register or to comment