Commit 211bc21d authored by Mikaël Salson's avatar Mikaël Salson

germlines: DDJ recombinations

Handle DDJ recombinations on TRD.
This corrects one bug but there are still some sequencesthat are not correctly segmented.
This should be further investigated.
parent 682735e3
......@@ -10,7 +10,7 @@ OTHER_SRC=$(wildcard unit-tests/*.cpp)
LIB=../core/vidjil.a ../lib/lib.a
SHOULD=$(wildcard should-get-tests/*.should-get)
SHOULD_LOG=$(SHOULD:.should-get=.tap)
SHOULD_VDJ_EXPECTED_FAILS=--expected-fails 85
SHOULD_VDJ_EXPECTED_FAILS=--expected-fails 84
SHOULD_LOCUS_EXPECTED_FAILS=--expected-fails 3
SHOULD_VDJ=$(wildcard should-vdj-tests/*.should-vdj.fa)
SHOULD_LOCUS=$(wildcard should-vdj-tests/*.should-locus.fa)
......
......@@ -18,7 +18,7 @@ GAAtcGAtAttGCAAAGAACCtGGCtGtACttAAGatACttGCACCAtCAGaGaGaGAtGAAGgGtCttACtACtGtGCC
# TRDD2*01 GTGTTTCATTGTGCCTTCCTAC ||||||||||
# TRDD3 ACTGGGGGATACG ||||||||||||||||||
# TRDJ1*01 acaccgataaactcatctttg
>TRDD2*01 0/GTGA/3 TRDD3 0/CC/3 TRDJ1*01 [TRD+] BUG
>TRDD2*01 0/GTGA/3 TRDD3 0/CC/3 TRDJ1*01 [TRD+]
AgcgggtggtgatggcaaagtgccaaggaaagggaaaaaggaagaagagggtttttatactgatgTGTTTCATTGTGCCTTCCTAC
GTGA
GGGGGATACG
......
......@@ -94,6 +94,7 @@
"3": ["TRDD3_downstream.fa"]
}, {
"5": ["TRDD2_upstream.fa"],
"4": ["TRDD.fa"],
"3": ["TRDJ.fa"]
}, {
"5": ["TRDD2_upstream.fa"],
......
Markdown is supported
0% or
You are about to add 0 people to the discussion. Proceed with caution.
Finish editing this message first!
Please register or to comment