Commit 1e4a2c24 authored by Thonier Florian's avatar Thonier Florian

fuse.py; add clone for doctest

link to #3902
parent 077fb8d3
......@@ -71,6 +71,17 @@ class Window:
>>> (w2 + w4).d["test"]
[0, 'plop']
>>> w1.control()["name"]
'not_segmented'
>>> w1.control()["top"]
3
>>> w7.control()["name"]
'TRAV17*010/CCGGGG/5TRAJ40*01'
>>> w7.control()["seg5"]
'TRAV17*01'
'''
### init Window with the minimum data required
......@@ -824,6 +835,79 @@ w5.d ={"id" : "aaa", "reads" : [5], "top" : 3 }
w6 = Window(1)
w6.d ={"id" : "bbb", "reads" : [12], "top" : 2 }
w7 = Window(1)
w7.d = {
"_average_read_length": [
149.625
],
"_coverage": [
0.9557226300239563
],
"_coverage_info": [
"143 bp (95% of 149.6 bp)"
],
"germline": "TRA",
"id": "TTCTTACTTCTGTGCTACGGACGCCGGGGCTCAGGAACCTACAAATACAT",
"name": "TRAV17*01 0/CCGGGG/5 TRAJ40*01",
"reads": [
16
],
"seg": {
"3": {
"delLeft": 5,
"name": "TRAJ40*01",
"start": 112
},
"5": {
"delRight": 0,
"name": "TRAV17*01",
"stop": 105
},
"N": 6,
"affectSigns": {
"seq": "++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++ +++++++++++++++++++ ",
"start": 1,
"stop": 143
},
"affectValues": {
"seq": "AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA___________________aaaaaaaaaaaaaaaaaaa_____________",
"start": 1,
"stop": 143
},
"cdr3": {
"aa": "ATDAG#SGTYKYI",
"start": 96,
"stop": 133
},
"evalue": {
"val": "9.170265e-66"
},
"evalue_left": {
"val": "0.000000e+00"
},
"evalue_right": {
"val": "9.170265e-66"
},
"junction": {
"aa": "CATDAG#SGTYKYIF",
"productive": False,
"start": 93,
"stop": 136
},
"quality": {
"seq": "!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!FGGDGGGGGGGGGGGGGGFECGGFDEFEFEEFDFFEGFGGGFFFFGDFEE!!!!!!!!!!!",
"start": 1,
"stop": 143
}
},
"seg_stat": {
"2": 7,
"3": 9
},
"sequence": "GTGGAAGATTAAGAGTCACGCTTGACACTTCCAAGAAAAGCAGTTCCTTGTTGATCACGGCTTCCCGGGCAGCAGACACTGCTTCTTACTTCTGTGCTACGGACGCCGGGGCTCAGGAACCTACAAATACATCTTTGGAACAG",
"top": 26
}
lw1 = ListWindows()
lw1.d["timestamp"] = 'ts'
lw1.d["reads"] = json.loads('{"total": [30], "segmented": [25], "germline": {}, "distribution": {}}', object_hook=lw1.toPython)
......
Markdown is supported
0% or
You are about to add 0 people to the discussion. Proceed with caution.
Finish editing this message first!
Please register or to comment