Commit 1e497e54 authored by Mathieu Giraud's avatar Mathieu Giraud

tests: testing AIRR output on S22 and X5

parent 13f901e5
!LAUNCH: $VIDJIL_DIR/$EXEC $VIDJIL_DEFAULT_OPTIONS -c clones -z 2 -3 -g $VIDJIL_DIR/germline/homo-sapiens.g:IGH $VIDJIL_DATA/Stanford_S22.fasta > /dev/null ; cat out/Stanford_S22.tsv
$ There are four lines, all with tabs
4:
4:\t
$ The required AIRR fields are present
:consensus_count
:v_call d_call j_call
:sequence_id
:sequence
:sequence_alignment
:germline_alignment
:v_cigar d_cigar j_cigar
$ Three clones on IGH
3:IGH
$ One clone has 8 reads, two clones have 5 reads
1:IGH 8
2:IGH 5
$ v_call for 2 clones (-z 2)
2:IGHV
$ First clone window appears third times (clone_id, sequence_id, sequence)
w3:TATTACTGTACCCGGGAGGAACAATATAGCAGCTGGTACTTTGACTTCTG
$ No spurious character
0:"
0:@
0:\\
!LAUNCH: $VIDJIL_DIR/$EXEC $VIDJIL_DEFAULT_OPTIONS -c clones -z 2 -2 -3 -r 1 -g $VIDJIL_DIR/germline/homo-sapiens.g ../should-vdj-tests/Demo-X5.should-vdj.fa > /dev/null ; cat out/Demo-X5.should-vdj.tsv
$ There are 15 = 1 + 14 lines, all with tabs
15:
15:\t
$ All clones have 1 reads
14: \t1\t
$ 8 clones with TR recombinations, some of them having special recombinations
2:TRA
1:TRA[+]D
2:TRB
1:TRB[+]
1:TRG
3:TRD
2:TRD[+]
$ One recombination with KDE
1:KDE
$ No spurious character
0:"
0:@
0:\\
Markdown is supported
0% or
You are about to add 0 people to the discussion. Proceed with caution.
Finish editing this message first!
Please register or to comment