Commit 18ce10f2 authored by Mikaël Salson's avatar Mikaël Salson

data/segmentation-2.fa: Small change in random sequence

That random sequence was supposed to have too few v/j information (because
it's random!). However, because of bad luck there was some tiny similarities
with IGH but the sequence was not segmented due to inconsistencies with the
strand.
This is still cool because the random sequence is not segmented. However here
we just want to test that a sequence with too few v/j is reported as such. As
the strand consistency is tested first in our algorithm, we didn't report the
too few v/j information. Therefore I modified a single nucleotide in the
sequence to get rid of this strand inconsistency.

I think I always feel guilty when modifying a test example. That's probably
why I needed to make such a long comment.

See !148
parent f5c1d159
......@@ -3,7 +3,7 @@
# Sequences outside any V(D)J locus
>too_few_vj-1
CTAGGCATGGCTCCTCTCCACAGGAAAACTCCACTCCAGTGCTCAGCTTGCACCCTGGCACAGGCCAGCAGTTGCTGGAAGTCAGACACCTGAGAAGAAC
CTAGGCATGGCTCCTCTCCACAGGAAAACTCCACTCCAGTGCTCAGCTTGCACCCTGGCACAGGCCAGCAGTTGCTGGAAGTCAGACACCTGTGAAGAAC
>too_few_vj-2
GCCTCAGGCCAGCCTTCCGCTCCTTGAAGCTGGTCTCCGCACAGTGCTGGTTCCGTCACCCCCACCCAGGGAAGCAGGTCTGAGCAGCTTGTCCTGGCTG
......
Markdown is supported
0% or
You are about to add 0 people to the discussion. Proceed with caution.
Finish editing this message first!
Please register or to comment