Commit 0f9ad87c authored by Mikaël Salson's avatar Mikaël Salson

QC30.should-vdj.fa: TRGJ2*01 is better than TRGJ1*01

TRGJ1*01 has one mutation while TRGJ2*01 hasn't. It's the only difference.
TRGJ1*02 is even slightly better as it has no mutation too but fewer deletions
at the 5' end.
parent 2f7a1fd1
......@@ -10,8 +10,8 @@ TGCCGGGCAGTCAGGGCATTAGAAATGATTTAGGCTGGTATCAGCAGAAACCAGGGNAAAGCCCCTAAGCTCCTGATCTA
>TRDV2*03 2/4/3 TRAJ48*01 [TRA+D]
ACTGGTACAGGAAGACCCAAGGTAACACAATGACTTTCATATACCGAGAAAAGGACATCTATGGCCCTGGTTTCAAAGACAATTTCCAAGGTGACATTGATATTGCAAAGAACCTGGCTGTACTTAAGATACTTGCACCATCAGAGAGAGATGAAGGGTCTTACTACTGTGCCTGTGACAGAGACTAACTTTGGAAATGAGAAATTAACCTTTGGGACTGGAACAAGACTCACCATCATACCCAGTAAGTTCTTCATCCTTGGTCAGGAAATCAGCCTGCATAAGATTCTGGGGAA
>TRGV5*01 (5/4/3 TRGJ1*01, 5/4/0 TRGJ1*02) [TRG]
>TRGV5*01 (5/4/3 TRGJ2*01, 5/4/0 TRGJ1*02) [TRG]
TTCCGTTCTNCCAACTNCAANGGNNGGTNGTTGGGAATCAGGNACTCAGTNCCAGGNAAAGTATTATACTCATACACCCAGGAGGTGGAGCTGGATATTGATACTACGAAATCTAATTGAAAATGATTCTGGGGTCTATTACTGTGCCACCTGGGCCTTTTATTATAAGAAACTCTTTGGCAGTGGAACAACACTTGTTGTCACAGGTAAGTATCGGAAGAAA
>TRGV4*02 (4/4/4 TRGJ1*01, 4/4/1 TRGJ1*02, 1/1/1 TRGJ1*02) [TRG]
>TRGV4*02 (4/4/1 TRGJ2*01, 1/1/1 TRGJ2*01, 4/4/1 TRGJ1*02, 1/1/1 TRGJ1*02) [TRG]
GGTTTTNTTCGTTGCCNTCCNTTTTTTGNTGGAATCAGGAATCAGCCCAGGGAAAGTATGATACTTACGGAAGCACAAGGTAAGAACTTGAGAATGATACTGCGAAATCTTATTGAAAATGACTCTGGAGTCTATTACTGTGCCACCTGGGAAGGCTATTATAAGAAACTCTTTGGCAGTGGAACAACACTTGTTGTCACAGGTAAGTATCGGAAGATATTCC
\ No newline at end of file
Markdown is supported
0% or
You are about to add 0 people to the discussion. Proceed with caution.
Finish editing this message first!
Please register or to comment