Commit 0c83ea37 authored by Mikaël Salson's avatar Mikaël Salson

segmenter_test.js: Don't add sequence directly to segmenter but select them

parent 81f150f4
......@@ -100,8 +100,8 @@ QUnit.test("segt", function (assert) {
var segment = new Segment("segment",m)
assert.equal(m.clone(3).getSequenceName(), "test4", "clone");
......@@ -128,6 +128,7 @@ QUnit.test("segt", function (assert) {
assert.equal(m.clone(3).getSegLength('test_feature'),31, "feature length");
assert.equal(segment.toFasta(), "");;
assert.ok(segment.isDNA('CACCCAGGAGGTGGAGCTGGATATTGAGACT'), "test dna")
Markdown is supported
0% or
You are about to add 0 people to the discussion. Proceed with caution.
Finish editing this message first!
Please register or to comment