Commit 090658b7 authored by Mikaël Salson's avatar Mikaël Salson

algo/tests: Testing unexpected recombination

From #2549
parent 4a2c6cf9
Pipeline #34247 passed with stages
in 49 minutes and 46 seconds
>seq
CACCATCAGCAGCCTGCAGCCTGAAGATTTTGCAACTTATTACTGTCACTCTGTTGACAGTAATAAGTTGCAAAA
!LAUNCH: $VIDJIL_DIR/$EXEC $VIDJIL_DEFAULT_OPTIONS -g $VIDJIL_DIR/germline -A -2 $VIDJIL_DATA/2549.fa
$ The KmerSegmenter segments the chimera on xxx germline (-2)
1:unexpected .* -> .* 1
$ The FineSegmenter gives the locus information (-2)
1:Unexpected .*\+IGKV/-IGKV
Markdown is supported
0% or
You are about to add 0 people to the discussion. Proceed with caution.
Finish editing this message first!
Please register or to comment