Commit 07cb3373 authored by Yann Ferret's avatar Yann Ferret Committed by Mikael Salson

should-vdj-tests: Sequences carefully curated

parent ea66e02c
>TRDV2*02_6/CGGGGCCC/3_TRDD3*01_5//27_TRAJ29*01__VdJa
ATACCGAGAAAAGGACATCTATGGCCCTGGTTTCAAAGACAATTTCCAAGGTGACATTGATATTGCAAAGAACCTGGCTGTACTTAAGATACTTGCACCATCAGAGAGAGATGAAGGGTCTTACTACTGTGCCTCGGGGCCCGGGGGTTGGAAAGGGCACAAGACTTTCTGTGATTGCAAGTAAGTGTTTCTAGCCATCCTTGATTTTGATCAGCAATGGCTTCTTCCCTTGAATTATTTTTCAGTGTACCTAGAATGCTTTTGCC
\ No newline at end of file
>TRDV2*02_3/TGGTGG/3_TRDD3*01_3/CCCACCTCACTTG/3_TRAJ29*01__VdJa
ATACCGAGAAAAGGACATCTATGGCCCTGGTTTCAAAGACAATTTCCAAGGTGACATTGATATTGCAAAGAACCTGGCTGTACTTAAGATACTTGCACCATCAGAGAGAGATGAAGGGTCTTACTACTGTGCCTGTGTGGTGGGGGGGATCCCACCTCACTTGATTCAGGAAACACACCTCTTGTCTTTGGAAAGGGCACAAGACTTTCTGTGATTGCAAGTAAGTGTTTCTAGCCATCCTTGATTTTGATCAGCAATGGCTTCTTCCCTTGAATTATTTTTCAGTGTACCTAGAATGCTTTTGCC
\ No newline at end of file
>TRDV2*02_14/TCCCGGCCT/0_TRDD3*01_3/CCACGGC/4_TRAJ29*01__VdJa
ATACCGAGAAAAGGACATCTATGGCCCTGGTTTCAAAGACAATTTCCAAGGTGACATTGATATTGCAAAGAACCTGGCTGTACTTAAGATACTTGCACCATCAGAGAGAGATGAAGGGTCTTACTATCCCGGCCTACTGGGGGATCCACGGCTTCAGGAAACACACCTCTTGTCTTTGGAAAGGGCACAAGACTTTCTGTGATTGCAAGTAAGTGTTTCTAGCCATCCTTGATTTTGATCAGCAATGGCTTCTTCCCTTGAATTATTTTTCAGTGTACCTAGAATGCTTTTGCC
>TRDD2*01_18//4_TRAJ29*01__VdJa
AGCGGGTGGTGATGGCAAAGTGCCAAGGAAAGGGAAAAAGGAAGAAGAGGGTTTTTATACTGATGTGTTTCATGGAAGGGACACCTCTTGTCTTTGGAAAGGGCACAAGACTTTCTGTGATTGCAAGTAAGTGTTTCTAGCCATCCTTGATTTTGATCAGCAATGGCTTCTTCCCTTGAATTATTTTTCAGTGTACCTAGAATGCTTTTGCC
\ No newline at end of file
# Sequence with a TRDD/TRDD/TRAJ recombination
# We should obtain TRDD2*01 -0/0/-2 TRDD3*01 -3/13/-14 TRAJ29*01
# but we are not seeking for two Ds at the time. So we will restrict
# to the 5' and 3' genes.
>TRDD2*01_0/TGGGGGATCCCCATTGGAGGG/14_TRAJ29*01__VdJa
AGCGGGTGGTGATGGCAAAGTGCCAAGGAAAGGGAAAAAGGAAGAAGAGGGTTTTTATACTGATGTGTTTCATTGTGCCTTCTTACTGGGGGATCCCCATTGGAGGGACACCTCTTGTCTTTGGAAAGGGCACAAGACTTTCTGTGATTGCAAGTAAGTGTTTCTAGCCATCCTTGATTTTGATCAGCAATGGCTTCTTCCCTTGAATTATTTTTCAGTGTACCTAGAATGCTTTTGCC
\ No newline at end of file
Markdown is supported
0% or
You are about to add 0 people to the discussion. Proceed with caution.
Finish editing this message first!
Please register or to comment