Commit 064521ab authored by Mikael Salson's avatar Mikael Salson

should-get-tests/10-md5-germline.should-get: Germline changes due to up/downstream

Consequence of #3009
parent a79ff8de
......@@ -56,20 +56,20 @@ $ Check md5 in germline/, other sequences
1:d5123a856e2dedacfcfcd5fd11ebc2bc homo-sapiens/IGHC=G4.fa
1:6c1e3e61d5824a03f71a5527ccdbb35c homo-sapiens/IGHC=GP.fa
1:dd2263230c64abb9a22f5f8b7a979275 homo-sapiens/IGHC=M.fa
1:2ed67cdd3d8f8fe3096afe747a0df205 homo-sapiens/IGHD.up.fa
1:a13a4c31570952c6c7fc1e7161051675 homo-sapiens/IGHJ.down.fa
1:cbf6cde7e7391c58229f815034cfbfa3 homo-sapiens/IGHD.up.fa
1:3fb492cfdbd9f9e640d15e457f7af82f homo-sapiens/IGHJ.down.fa
1:7d6247262807ad5478b7a4e52a59c568 homo-sapiens/IGK-INTRON.fa
1:17d62684cad533025a25401cf7974d50 homo-sapiens/IGKJ.down.fa
1:1147a04c4e8a8dd534aae65db1ae13ca homo-sapiens/IGK-KDE.fa
1:805f326b92db78d8276b5a58b0f93fa2 homo-sapiens/IGKJ.down.fa
1:9f37008bdabf1d7102d753845e36309e homo-sapiens/IGLJ.down.fa
1:68e06198c4f41898533fecd30b86a446 homo-sapiens/TRAJ.down.fa
1:79f9526d456d4550c1451a67e34efa51 homo-sapiens/TRBD.up.fa
1:052da0d01539810a3ede514ade7ec988 homo-sapiens/TRBJ.down.fa
1:e0a1860c5f9f937800c4b9d090f0c8aa homo-sapiens/TRDD.up.fa
1:4f1d8f0e508e7e40adbd8896b64a905c homo-sapiens/TRDD2.up.fa
1:d8017c8ee68383b874f7ff00efab0db6 homo-sapiens/TRDD3.down.fa
1:a0a77c861cb4abc5222fad9da143e2b9 homo-sapiens/TRDJ.down.fa
1:f1ae8b4f91c3ab3cad31e490f09eeff0 homo-sapiens/TRGJ.down.fa
1:c7ff31249a38e29429f5e6144123274a homo-sapiens/IGLJ.down.fa
1:25fb374147fdf5e73242b7776d9d73e2 homo-sapiens/TRAJ.down.fa
1:86ff6637be816b145fd69153d84bbcf1 homo-sapiens/TRBD.up.fa
1:a6cf4d4ea828cabba9061fa794662fff homo-sapiens/TRBJ.down.fa
1:ff05546d9fa09c81c82914c8af19c3a0 homo-sapiens/TRDD2.up.fa
1:7104ce2e1fc0461d475026c2a560947b homo-sapiens/TRDD3.down.fa
1:fa8fce50396e96bb7eed892f68717957 homo-sapiens/TRDD.up.fa
1:ee091b204ffdcf2b29b60d7c4435abe5 homo-sapiens/TRDJ.down.fa
1:bec6c2dfa3c4535b87a89f9ade4a25e0 homo-sapiens/TRGJ.down.fa
1:48f54c5af4f8d748ab2f02b2a6ea3370 mus-musculus/IGHC=A.fa
1:25cb0451d31ca5337d462eb648914fe7 mus-musculus/IGHC=D.fa
1:8f2ec40bc77a4e7f0c7b19655812ddbc mus-musculus/IGHC=E.fa
......@@ -79,25 +79,25 @@ $ Check md5 in germline/, other sequences
1:03cd9b5729ec3de23b302c476a51c9d3 mus-musculus/IGHC=G2C.fa
1:744e59a4b5d1fc53beae91a0bee8f34a mus-musculus/IGHC=G3.fa
1:b72bc2ed53226dd68519bb0cb679f608 mus-musculus/IGHC=M.fa
1:bacb56a07cfcd93a4734fa25a832a805 mus-musculus/IGHD.up.fa
1:07cd7e934d5ad5b804b5e8008c3f6662 mus-musculus/IGHJ.down.fa
1:94cb5eaa7f9b1732fe9f21bfaee11af7 mus-musculus/IGKJ.down.fa
1:8b2a0ea8303c8bc21ca6c9669a91cc7a mus-musculus/IGLJ.down.fa
1:f3840f00f202cafd36d2cd3b17608bbd mus-musculus/TRAJ.down.fa
1:60ad210f435d4f31b37f0254bf9d96fe mus-musculus/TRBD.up.fa
1:8be584820144e5f8960ac71361752f10 mus-musculus/TRBJ.down.fa
1:97a0118ff5659b8e46e937e3b4afa43c mus-musculus/TRDD.up.fa
1:b1e00c7630580fd3c79801ae9174734d mus-musculus/TRDD2.up.fa
1:5481f5e78573695406baa58a04689d2c mus-musculus/TRDJ.down.fa
1:1d823716238ad85afe903fa7db8604c2 mus-musculus/TRGJ.down.fa
1:123ebf4aaaa3b530c1911c0febcd74a5 mus-musculus/IGHD.up.fa
1:8353980dac74af8bffe3de0b746a897e mus-musculus/IGHJ.down.fa
1:f6282c17fb689899d37627df79194b38 mus-musculus/IGKJ.down.fa
1:9716ccba4912b32c462cad5c0cd82bed mus-musculus/IGLJ.down.fa
1:d3e2887e41fac79c6287c630050dcffe mus-musculus/TRAJ.down.fa
1:89bcd757dfd42615307d9970307f6e01 mus-musculus/TRBD.up.fa
1:29d23ea1a84881b21bcf38cd004b94e3 mus-musculus/TRBJ.down.fa
1:a3dd73f39e659c3008d3f595c7731792 mus-musculus/TRDD2.up.fa
1:ffa36242abfedd81c563ddf74a8d304a mus-musculus/TRDD.up.fa
1:c709bb05205022b0aefad45b4eb72169 mus-musculus/TRDJ.down.fa
1:a234e3568f9553eef28799b8d5189d81 mus-musculus/TRGJ.down.fa
1:90075c7d51bd1d08892163848a8f2ecc rattus-norvegicus/IGHC=A.fa
1:e0d2d3e90980bf783e35d3775a3c327d rattus-norvegicus/IGHC=D.fa
1:6cf27ae32f98ec8f912e0d07b46a2139 rattus-norvegicus/IGHC=D.fa
1:8461bb440ad2264eb638d948bda186ab rattus-norvegicus/IGHC=E.fa
1:72537faac0e87d1265c7806c300a41ce rattus-norvegicus/IGHC=G1.fa
1:4234f1b5e763f51782c88358e2085714 rattus-norvegicus/IGHC=G2A.fa
1:6f2605929ae226fd7ebaf9b40d948a85 rattus-norvegicus/IGHC=G2B.fa
1:36f7704ea32dbc0eb71c4ffbe459c23c rattus-norvegicus/IGHC=G2C.fa
1:a27b6fc827063a041062a8b4b2945232 rattus-norvegicus/IGHC=M.fa
1:a122818ff4b6ef5e2013a1ae1c493425 rattus-norvegicus/IGHD.up.fa
1:84362ee627d5e3d78579aedc18ba6aef rattus-norvegicus/IGHD.up.fa
1:3445516778ab4fbf96cf4008a40e6fe2 rattus-norvegicus/IGHJ.down.fa
1:69aa6db3bb8a332289ab3b5cf5ab3b5a rattus-norvegicus/IGLJ.down.fa
1:50d821031cee5e1a3849966fafdc2ad5 rattus-norvegicus/IGLJ.down.fa
......@@ -9,7 +9,7 @@ CGTGGCACCGCGAGCTGTAGACAGAGCCGCGGTCTTTCTCGATTGAGTGGCTTTGGTGGCCATGCCACCGCGCTCTTGGG
>IGKV3-7*04 1/GTGGA/11 KDE [IGK+]
CCCAGGCTCCTCATCTATGATGCATCCACCAGGGCCACTAGCATCCCAGCCAGGTTCAGTGGCAGTGGGTCTGGGACAGACTTCACTCTCACCATCAGCAGCCTGCAGCCTGAAGATTTTGCAGTTTATTACTGTCAGCAGGATTATAACTTACCTCGTGGAGGCAGCCCAGGGCGACTCCTCATGAGTCTGCAGCTGCATTTTTGCCATATCCACTATTTGGAGTCTGACCTCCCTAGGAAGCCTCCCTGCTCCCTAGGACAACCTGCTCTGACCTCTGAGG
>TRGV2*01 9/CCCTGG/1 TRGJP1*01 [TRG] {CATPW!TTGWFKIF}
>TRGV2*03 9/CCCTGG/1 TRGJP1*01 [TRG] {CATPW!TTGWFKIF}
GGAAGGCCCCACAGCGTCTTCAGTACTATGACTCCTACAACTCCAAGGTTGTGTTGGAATCAGGAGTCAGTCCAGGGAAGTATTATACTTACGCAAGCACAAGGAACAACTTGAGATTGATACTGCGAAATCTAATTGAAAATGACTTTGGGGTCTATTACTGTGCCACCCCCTGGTACCACTGGTTGGTTCAAGATATTTGCTGAAGGGACTAAGCTCATAGTAACTTCGCCTGGTAA
# or TRGJ1*01
......
......@@ -11,7 +11,7 @@ TTTGACTACTGGGGCCAGGGAACCCTGGTCACCGTCTCCTCAGGTAAG
# target 1297RC
>IGHV2-70D*04 4/TCCCG/10 IGHD3-10*01 10/CCTTG/0 IGHJ5*02 [IGH]
>(IGHV2-70D*04, IGHV2-70*04) 4/TCCCG/10 IGHD3-10*01 10/CCTTG/0 IGHJ5*02 [IGH]
gacctgcaccttctctgggttctcactcagcactagtggaatgcgtgcgagctggatccgtcagcccccagg
gaaggccctggagtggcttgcacgcattgattgggatgatgataaattctacagcacatctctgaagaccag
gctcaccatctccaaggacacctccaaaaaccaggtggtccttacaatgaccaacatggaccctgtggacac
......
......@@ -80,7 +80,7 @@ GCTGGCAGATTCTGCAGGCATCTGGATACACCTTCACCAGCTACTATATGCACTGGGTGCGACAGGCCCCTGGACAAGGG
CGGGGTAGTCTCCTGCAGCTTCTGGAGGCACCTTCAGCAGCTATGCTATCAGCTGGGTGCGACAGGCCCCTGGACAAGGGCTTGAGTGGATGGGAGGGATCATCCCTATCTTTGGTACAGCAAACTACGCACAGAAGTTCCAGGGCAGAGTCACGATTACCGCGGACGAATCCACGAGCACAGCCTACATGGAGCTGAGCAGCCTGAGATCTGAGGACACGGCCGTGTATTACTGTGCGAGGGGGGGCTGGAACTACTACTACGGTATGGACGTCTGGGGCCAAGGGACCACGGTCACCGTCTCCTCAGGTAAAACTTATCCTTGGAAAGACGTCATCCGTAGTAGTAGTTCAGCCCCCCTGCCGTAATACAGGCCGTGTCTCGATCTCAGCGGCTCACTCCTGGTGGGCTGTGCTTGTGGAATTCTCCCGGTAATCGTGACTTTGCCCTGGAAATTCTATGCCTATTGTTGCTGGACC
#1428 vh2
>IGHV2-70*04 IGHJ6*02 [IGH] BUG
>(IGHV2-70*04, IGHV2-70D*04) IGHJ6*02 [IGH]
CCACAGACCCTCACACTGACCTGCACCTTCTCTGGGTTCTCACTCAGCACTAGTGGAATGCGTGTGAGCTGGATCCGTCAGCCCCCAGGGAAGGCCCTGGAGTGGCTTGCACGCATTGATTGGGATGATGATAAATTCTACAGCACATCTCTGAAGACCAGGCTCACCATCTCCAAGGACACCTCCAAAAACCAGGTGGTCCTTACAATGACCAACATGGACCCTGTGGACACAGCCACGTATTACTGTGTTGGTATGGACGTCTGGGGCCAAGGGACCACGGTCACCGTCTCCTCAGGTAAAACCACGTCCTTGGCCCGACTCCATACCACACCTAATACCTGGCTGTGTCCACGAGGATCCATGGTTGGGCATTGTAGGACCACTGGTTTTTGGAAGTTCCCTTGAGAAAAGAAAAACAGAATCTTCAAAAAA
#1428 vh3
......@@ -156,7 +156,7 @@ AGCTCTGCTGATTTGTGGGCACTTATGAACCCGAAAGGACATGGCCATGGGGTGGGTAGGGACATAGGGACAGATGCCAG
CGCCCCACTTGATATTCCTTTTAGCCAGCTATGCCATGAGCTGGGTCCGCCAGGCTCCAGGGAAGGGGCTGGAGTGGGTCTCAGCTATTAGTGGTAGTGGTGGTAGCACATACTACGCAGACTCCGTGAAGGGCCGGTTCACCATCTCCAGAGACAATTCCAAGAACACGCTGTATCTGCAAATGAACAGCCTGAGAGCCGAGGACACGGCCGTATATTACTGTGCGAAAGGGTGGGAGGTATTAAACTATGGTTCGGGGAGTTATTATAACGTTGATGCTTTTGATATCTGGGGCCAAGGGACAATGGTCACCGTCTCCTCAGGTAACTC
#1347 vh2
>IGHV2-26*01 0/5/5 IGHD5-24*01 4/13/7 IGHJ4*02 [IGH]
>IGHV2-26*02 0/5/5 IGHD5-24*01 4/13/7 IGHJ4*02 [IGH]
TCAGAGACCTCACGCTGACCTGCACCGTCTCTGGGTTCTCACTCAGCAATGCTAGAATGGGTGTGAGCTGGATCCGTCAGCCCCCAGGGAAGGCCCTGGAGTGGCTTGCACACATTTTTTCGAATGACAAAAAATCCTACAGCACATCTCTGAAGAGCAGGCTCACCATCTCCAAGGACACCTCCAAAAGCCAGGTGGTCCTTACCATGACCAATATGGACCCTGTGGACACAGCCACATATTACTGTGCATGGATACCCGAGGATGGCTACAACGACAAGAGCCAATGACTACTGGGGCCAGGGAACGCTGGTCACCGTCTCCTCAGGTAAATCCATGCACAGTAATATGTGGCTGTGTCCACAGGGTCCATATTGGTCATGGTAAGGACCACCTGGCTTTTGGAGGTGTCCTTGGAGA
#1339 vh3
......
Markdown is supported
0% or
You are about to add 0 people to the discussion. Proceed with caution.
Finish editing this message first!
Please register or to comment