Commit 0353190c authored by Mikaël Salson's avatar Mikaël Salson

Merge branch 'feature-a/4017-output-crd3-nt' into 'dev'

Feature a/4017 - Output CDR3 nt

Closes #4017

See merge request !532
parents 62b31092 ed4d5b61
Pipeline #104281 passed with stages
in 9 minutes and 24 seconds
......@@ -1325,7 +1325,9 @@ void FineSegmenter::findCDR3(){
}
else
{
// start of codon fully included in the germline J
// Non-productive CDR3
// We want to output a '#' somewhere around the end of the N, and then restart
// at the start of the first codon fully included in the germline J
int CDR3startJfull = JUNCTIONend - ((JUNCTIONend - box_J->start) / 3) * 3 + 1 ;
CDR3aa =
......@@ -1391,6 +1393,7 @@ void FineSegmenter::toOutput(CloneOutput *clone){
clone->setSeg("cdr3", {
{"start", CDR3start},
{"stop", CDR3end},
{"seq", CDR3nuc},
{"aa", CDR3aa}
});
}
......
......@@ -53,7 +53,7 @@ $ Segmentation details - N1, N2
1:"N2": 0,
$ Segmentation details - CDR3, JUNCTION
1:"cdr3": ."aa": "TREEQYSSWYFDF", "start": 73, "stop": 111.
1:"cdr3": ."aa": "TREEQYSSWYFDF", "seq": "ACCCGGGAGGAACAATATAGCAGCTGGTACTTTGACTTC", "start": 73, "stop": 111.
1:"junction": ."aa": "CTREEQYSSWYFDFW", .* "start": 70, "stop": 114.
$ Second sequence has a DNA sequence provided
......
Markdown is supported
0% or
You are about to add 0 people to the discussion. Proceed with caution.
Finish editing this message first!
Please register or to comment