igh-vdj.should-vdj.fa 822 Bytes
Newer Older
1
>IGHV 0//0 IGHD1-1*01 0//0 IGHJ1*01 [IGH]
2 3 4 5
actgtgcgagaga
ggtacaactggaacgac
gctgaatacttcc

6
>(IGHV1-18*01, IGHV1-18*04) 0//0 IGHD3-16*01 0//0 IGHJ4*01  [IGH]
7 8 9 10 11
agcctacatggagctgaggagcctgagatctgacgacacggccgtgtattactgtgcgagaga
gtattatgattacgtttgggggagttatgcttatacc
actactttgactactggggccaaggaaccctggtcaccgtctcctcag

# Same sequence, but with only the 20bp start of J
12
>(IGHV1-18*01, IGHV1-18*04) 0//0 IGHD3-16*01 0//0 (IGHJ4*01, IGHJ4*02)  [IGH] BUG
13 14 15
agcctacatggagctgaggagcctgagatctgacgacacggccgtgtattactgtgcgagaga
gtattatgattacgtttgggggagttatgcttatacc
actactttgactactggggcc
16 17

# Same sequence, but with only the 15bp start of J
18
>(IGHV1-18*01, IGHV1-18*04) 0//0 IGHD3-16*01 0//0 (IGHJ4*01, IGHJ4*02)  [IGH] BUG-LOCUS
19 20 21
agcctacatggagctgaggagcctgagatctgacgacacggccgtgtattactgtgcgagaga
gtattatgattacgtttgggggagttatgcttatacc
actactttgactactg